Caveolin 2 (CAV2) (NM_198212) Human Untagged Clone

CAT#: SC307649

CAV2 (untagged)-Human caveolin 2 (CAV2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CAV2
• Synonyms: CAV
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_198212, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGCTGGAGACGGAGAAGGCGGACGTACAGCTCTTCATGGACGACGACTCCTACAGCCACCACAGCG
  GCCTCGAGTACGCCGACCCCGAGAAGTTCGCGGACTCGGACCAGGACCGGGATCCCCACCGGCTCAACTC
  GCATCTCAAGGATTTTAATGCCTTTTGTAAAGACCTGCCTAATGGTTCTGCCTTCAGTGCAGACAATATG
  GAAGAGTGTGACAGATGTTATCATTGCTCCATTGTGTACGAGCGTAGGACGATGCTTCTCTTCTGTCAGC
  CTGCAACTGAGCCAGGATTGAATACTTGGACCCCAGGTCTGGAGATTGGGATACTGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_198212
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_198212.2, NP_937855.1
• RefSeq Size: 2933 bp
• RefSeq ORF: 339 bp
• Locus ID: 858
• Cytogenetics: 7q31.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Focal adhesion
• Gene Summary: 'The protein encoded by this gene is a major component of the inner surface of caveolae, small invaginations of the plasma membrane, and is involved in essential cellular functions, including signal transduction, lipid metabolism, cellular growth control and apoptosis. This protein may function as a tumor suppressor. This gene and related family member (CAV1) are located next to each other on chromosome 7, and express colocalizing proteins that form a stable hetero-oligomeric complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Additional isoforms resulting from the use of alternate in-frame translation initiation codons have also been described, and shown to have preferential localization in the cell (PMID:11238462). [provided by RefSeq, May 2011]'
  Transcript Variant: This variant (2) lacks a coding exon compared to variant 1. This results in a frame-shift and a shorter isoform (c) with a distinct C-terminus compared to isoform a.