ING1 (NM_198217) Human Untagged Clone

CAT#: SC307651

ING1 (untagged)-Human inhibitor of growth family, member 1 (ING1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ING1
• Synonyms: p24ING1c; p33; p33ING1; p33ING1b; p47; p47ING1a
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_198217, the custom clone sequence may differ by one or more nucleotides
  ATGGAGATCCTGAAGGAGCTAGACGAGTGCTACGAGCGCTTCAGTCGCGAGACAGACGGG
  GCGCAGAAGCGGCGGATGCTGCACTGTGTGCAGCGCGCGCTGATCCGCAGCCAGGAGCTG
  GGCGACGAGAAGATCCAGATCGTGAGCCAGATGGTGGAGCTGGTGGAGAACCGCACGCGG
  CAGGTGGACAGCCACGTGGAGCTGTTCGAGGCGCAGCAGGAGCTGGGCGACACAGCGGGC
  AACAGCGGCAAGGCTGGCGCGGACAGGCCCAAAGGCGAGGCGGCAGCGCAGGCTGACAAG
  CCCAACAGCAAGCGCTCACGGCGGCAGCGCAACAACGAGAACCGTGAGAACGCGTCCAGC
  AACCACGACCACGACGACGGCGCCTCGGGCACACCCAAGGAGAAGAAGGCCAAGACCTCC
  AAGAAGAAGAAGCGCTCCAAGGCCAAGGCGGAGCGAGAGGCGTCCCCTGCCGACCTCCCC
  ATCGACCCCAACGAACCCACGTACTGTCTGTGCAACCAGGTCTCCTATGGGGAGATGATC
  GGCTGCGACAACGACGAGTGCCCCATCGAGTGGTTCCACTTCTCGTGCGTGGGGCTCAAT
  CATAAACCCAAGGGCAAGTGGTACTGTCCCAAGTGCCGGGGGGAGAACGAGAAGACCATG
  GACAAAGCCCTGGAGAAATCCAAAAAAGAGAGGGCTTACAACAGGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_198217
• ORF Size: 708 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_198217.1, NP_937860.1
• RefSeq Size: 2131
• RefSeq ORF: 708
• Locus ID: 3621
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) differs in the 5' end-region, which includes part of the coding region, compared to variant 4. The resulting isoform (C) has a shorter N-terminus, as compared to isoform D.