ING1 (NM_198217) Human Untagged Clone

CAT#: SC307651

ING1 (untagged)-Human inhibitor of growth family, member 1 (ING1), transcript variant 3


  "NM_198217" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ING1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ING1
Synonyms p24ING1c; p33; p33ING1; p33ING1b; p47; p47ING1a
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_198217, the custom clone sequence may differ by one or more nucleotides
ATGGAGATCCTGAAGGAGCTAGACGAGTGCTACGAGCGCTTCAGTCGCGAGACAGACGGG
GCGCAGAAGCGGCGGATGCTGCACTGTGTGCAGCGCGCGCTGATCCGCAGCCAGGAGCTG
GGCGACGAGAAGATCCAGATCGTGAGCCAGATGGTGGAGCTGGTGGAGAACCGCACGCGG
CAGGTGGACAGCCACGTGGAGCTGTTCGAGGCGCAGCAGGAGCTGGGCGACACAGCGGGC
AACAGCGGCAAGGCTGGCGCGGACAGGCCCAAAGGCGAGGCGGCAGCGCAGGCTGACAAG
CCCAACAGCAAGCGCTCACGGCGGCAGCGCAACAACGAGAACCGTGAGAACGCGTCCAGC
AACCACGACCACGACGACGGCGCCTCGGGCACACCCAAGGAGAAGAAGGCCAAGACCTCC
AAGAAGAAGAAGCGCTCCAAGGCCAAGGCGGAGCGAGAGGCGTCCCCTGCCGACCTCCCC
ATCGACCCCAACGAACCCACGTACTGTCTGTGCAACCAGGTCTCCTATGGGGAGATGATC
GGCTGCGACAACGACGAGTGCCCCATCGAGTGGTTCCACTTCTCGTGCGTGGGGCTCAAT
CATAAACCCAAGGGCAAGTGGTACTGTCCCAAGTGCCGGGGGGAGAACGAGAAGACCATG
GACAAAGCCCTGGAGAAATCCAAAAAAGAGAGGGCTTACAACAGGTAG
Restriction Sites Please inquire     
ACCN NM_198217
ORF Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_198217.1, NP_937860.1
RefSeq Size 2131
RefSeq ORF 708
Locus ID 3621
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' end-region, which includes part of the coding region, compared to variant 4. The resulting isoform (C) has a shorter N-terminus, as compared to isoform D.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.