HSD11B1L (NM_198704) Human Untagged Clone

CAT#: SC307779

HSD11B1L (untagged)-Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant f


  "NM_198704" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSD11B1L"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HSD11B1L
Synonyms 11-beta-HSD3; 11-DH3; HSD1L; HSD3; SCDR10; SCDR10B; SDR26C2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_198704, the custom clone sequence may differ by one or more nucleotides
ATGCAGGTAAACTTTGTGAGCTACGTGCAACTGACGTCGCGGGCGCTGCCCAGCCTGACG
GACAGCAAGGGCTCCCTGGTGGTGGTGTCCTCGCTGCTCGGCCGCGTGCCCACGTCGTTC
TCCACTCCCTACTCGGCGGCCAAGTTTGCGCTGGACGGCTTCTTCGGCTCCCTGCGGCGG
GAGCTGGACGTGCAGGACGTGAACGTGGCCATCACCATGTGCGTCCTGGGCCTCCGAGAT
CGCGCCTCCGCCGCCGAGGCAGTCAGGAGCTCAACGTCACGGCCGCGGCAGCCTGAGCAC
CGGGGGGTGCCCCTCCAGTCCCAGACGGCAATGTTCCTCCCTCCAACTGTCCCTGGAGCC
AGAACACTCACAGAGACACCCCTGAGAGGGTGGCCACAGCCCAAGATGAAGTCATCAAGA
CAGAAAAGCAAAACCGAGAAAAACGACGGGCACCTGGAACCAGTCACGGCTTGGGAGGTG
CAGGTGCCCCGTGTTAGGCGCCTTTGTCGGGGACTTGCAAGGCCTCACCTGTTTGGCCAT
GATTGA
Restriction Sites Please inquire     
ACCN NM_198704
ORF Size 546 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_198704.1, NP_941993.1
RefSeq Size 1379
RefSeq ORF 546
Locus ID 374875
Protein Families Druggable Genome
Gene Summary This gene is a member of the hydroxysteroid dehydrogenase family. The encoded protein is similar to an enzyme that catalyzes the interconversion of inactive to active glucocorticoids (e.g. cortisone). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (f) has multiple differences in the coding region, one of which results in initiation of translation at a downstream in-frame start codon, compared to variant g. An additional difference results in a frameshift. The encoded protein (isoform f) has a distinct C-terminus and is shorter than isoform g.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.