HSD11B1L (NM_198708) Human Untagged Clone
CAT#: SC307781
HSD11B1L (untagged)-Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant d
"NM_198708" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HSD11B1L |
Synonyms | 11-beta-HSD3; 11-DH3; HSD1L; HSD3; SCDR10; SCDR10B; SDR26C2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_198708, the custom clone sequence may differ by one or more nucleotides
ATGCAGGTAAACTTTGTGAGCTACGTGCAACTGACGTCGCGGGCGCTGCCCAGCCTGACGGACAGCAAGG GCTCCCTGGTGGTGGTGTCCTCGCTGCTCGGCCGCGTGCCCACGTCGTTCTCCACTCCCTACTCGGCGGC CAAGTTTGCGCTGGACGGCTTCTTCGGCTCCCTGCGGCGGGAGCTGGACGTGCAGGACGTGAACGTGGCC ATCACCATGTGCGTCCTGGGCCTCCGAGATCGCGCCTCCGCCGCCGAGGCAGTCAGGGGAGTCACGAGGG TCAAGGCGGCCCCGGGGCCCAAGGCAGCCCTGGCCGTGATCCGCGGCGGCGCCACGCGCGCGGCCGGCGT CTTCTACCCGTGGCGTTTCCGCCTGCTGTGCTTGCTCCGGCGCTGGCTACCGCGCCCGCGGGCCTGGTTT ATCCGCCAGGAGCTCAACGTCACGGCCGCGGCAGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_198708 |
ORF Size | 459 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_198708.2, NP_941997.1 |
RefSeq Size | 1848 |
RefSeq ORF | 459 |
Locus ID | 374875 |
Protein Families | Druggable Genome |
Gene Summary | This gene is a member of the hydroxysteroid dehydrogenase family. The encoded protein is similar to an enzyme that catalyzes the interconversion of inactive to active glucocorticoids (e.g. cortisone). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (d) has multiple differences in the coding region, and initiates translation at an alternate downstream in-frame start codon, compared to variant g. The encoded isoform (d) is shorter than isoform g. Variants d and j encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221286 | HSD11B1L (Myc-DDK-tagged)-Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant d |
USD 420.00 |
|
RG221286 | HSD11B1L (GFP-tagged) - Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant d |
USD 460.00 |
|
RC221286L3 | Lenti ORF clone of Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant d, Myc-DDK-tagged |
USD 620.00 |
|
RC221286L4 | Lenti ORF clone of Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant d, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review