TSPAN3 (NM_198902) Human Untagged Clone

CAT#: SC307808

TSPAN3 (untagged)-Human tetraspanin 3 (TSPAN3), transcript variant 2


  "NM_198902" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TSPAN3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TSPAN3
Synonyms TM4-A; TM4SF8; TSPAN-3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_198902, the custom clone sequence may differ by one or more nucleotides
ATGGGCCAGTGCGGCATCACCTCCTCCAAGACCGTGCTGGTCTTTCTCAACCTCATCTTC
TGGGGGGCAGCTGGCATTTTATGCTATGTGGGAGCCTATGTCTTCATCACTTATGATGAC
TATGACCACTTCTTTGAAGATGTGTACACGCTCATCCCTGCTGTAGTGATCATAGCTGTA
GGAGCCCTGCTTTTCATCATTGGGCTAATTGGCTGCTGTGCCACAATCCGGGAAAGTCGC
TGTGGACTTGCCACGGTGGAAAATGAGGTTGATCGCAGCATTCAGAAAGTGTATAAGACC
TACAATGGAACCAACCCTGATGCTGCTAGCCGGGCTATTGATTATGTACAGAGACAGCTG
CATTGTTGTGGAATTCACAACTACTCAGACTGGGAAAATACAGATTGGTTCAAAGAAACC
AAAAACCAGAGTGTCCCTCTTAGCTGCTGCAGAGAGACTGCCAGCAATTGTAATGGCAGC
CTGGCCCACCCTTCCGACCTCTATGCTGAGGGGTGTGAGGCTCTAGTAGTGAAGAAGCTA
CAAGAAATCATGATGCATGTGATCTGGGCCGCACTGGCATTTGCAGCTATTCAGCTGCTG
GGCATGCTGTGTGCTTGCATCGTGTTGTGCAGAAGGAGTAGAGATCCTGCTTACGAGCTC
CTCATCACTGGCGGAACCTATGCATAG
Restriction Sites Please inquire     
ACCN NM_198902
ORF Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_198902.1, NP_944492.1
RefSeq Size 1767
RefSeq ORF 687
Locus ID 10099
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. Multiple alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.