MTH1 (NUDT1) (NM_198954) Human Untagged Clone

CAT#: SC307829

NUDT1 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 4B


  "NM_198954" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NUDT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NUDT1
Synonyms MTH1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_198954, the custom clone sequence may differ by one or more nucleotides


ATGAGTGGAATTAGCCCTCAGCAGATGGGGGAGCCAGAAGGCAGTTGGAGTGGGAAGAACCCAGGGACCA
TGGGCGCCTCCAGGCTCTATACCCTGGTGCTGGTCCTGCAGCCTCAGCGAGTTCTCCTGGGCATGAAAAA
GCGAGGCTTCGGGGCCGGCCGGTGGAATGGCTTTGGGGGCAAAGTGCAAGAAGGAGAGACCATCGAGGAT
GGGGCTAGGAGGGAGCTGCAGGAGGAGAGCGGTCTGACAGTGGACGCCCTGCACAAGGTGGGCCAGATCG
TGTTTGAGTTCGTGGGCGAGCCTGAGCTCATGGACGTGCATGTCTTCTGCACAGACAGCATCCAGGGGAC
CCCCGTGGAGAGCGACGAAATGCGCCCATGCTGGTTCCAGCTGGATCAGATCCCCTTCAAGGACATGTGG
CCCGACGACAGCTACTGGTTTCCACTCCTGCTTCAGAAGAAGAAATTCCACGGGTACTTCAAGTTCCAGG
GTCAGGACACCATCCTGGACTACACACTCCGCGAGGTGGACACGGTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_198954
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198954.1, NP_945192.1
RefSeq Size 801 bp
RefSeq ORF 540 bp
Locus ID 4521
Cytogenetics 7p22.3
Protein Families Stem cell - Pluripotency
Gene Summary 'Misincorporation of oxidized nucleoside triphosphates into DNA/RNA during replication and transcription can cause mutations that may result in carcinogenesis or neurodegeneration. The protein encoded by this gene is an enzyme that hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP, 8-oxo-dATP, 2-hydroxy-dATP, and 2-hydroxy rATP, to monophosphates, thereby preventing misincorporation. The encoded protein is localized mainly in the cytoplasm, with some in the mitochondria, suggesting that it is involved in the sanitization of nucleotide pools both for nuclear and mitochondrial genomes. Several alternatively spliced transcript variants, some of which encode distinct isoforms, have been identified. Additional variants have been observed, but their full-length natures have not been determined. A rare single-nucleotide polymorphism that results in the production of an additional, longer isoform (p26) has been described. [provided by RefSeq, Dec 2018]'
Transcript Variant: This variant (4B) differs in the 5' UTR and 5' coding region compared to variant 1, resulting in translation initiation at an upstream ATG and an isoform (p22, also known as MTH1b) with a longer N-terminus compared to isoform p18. Variants 2B, 3B, and 4B encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.