NDUF3 (NDUFAF3) (NM_199073) Human Untagged Clone
CAT#: SC307860
NDUFAF3 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 3
"NM_199073" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NDUFAF3 |
Synonyms | 2P1; C3orf60; E3-3; MC1DN18 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_199073, the custom clone sequence may differ by one or more nucleotides
ATGTACATCGACAGCTACAACAGCCGCGGCTTCATGATAAACGGAAACCGCGTGCTCGGC CCCTGCGCTCTGCTCCCGCACTCGGTGGTGCAGTGGAACGTGGGATCCCACCAGGACATC ACCGAAGACAGCTTTTCCCTCTTCTGGTTGCTGGAGCCCCGGATAGAGATCGTGGTGGTG GGGACTGGAGACCGGACCGAGAGGCTGCAGTCCCAGGTGCTTCAAGCCATGAGGCAGCGG GGCATTGCTGTGGAAGTGCAGGACACGCCCAATGCCTGTGCCACCTTCAACTTCCTGTGT CATGAAGGCCGAGTAACTGGAGCTGCTCTCATCCCTCCACCAGGAGGGACTTCACTTACA TCTTTGGGCCAAGCTGCTCAATGA |
Restriction Sites | Please inquire |
ACCN | NM_199073 |
ORF Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_199073.1, NP_951047.1 |
RefSeq Size | 1021 |
RefSeq ORF | 384 |
Locus ID | 25915 |
Gene Summary | This gene encodes a mitochondrial complex I assembly protein that interacts with complex I subunits. Mutations in this gene cause mitochondrial complex I deficiency, a fatal neonatal disorder of the oxidative phosphorylation system. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2, 3 and 4 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217754 | NDUFAF3 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 420.00 |
|
RG217754 | NDUFAF3 (GFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 460.00 |
|
RC217754L3 | Lenti-ORF clone of NDUFAF3 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 620.00 |
|
RC217754L4 | Lenti-ORF clone of NDUFAF3 (mGFP-tagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review