RCL (DNPH1) (NM_199184) Human Untagged Clone

CAT#: SC307891

DNPH1 (untagged)-Human chromosome 6 open reading frame 108 (C6orf108), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DNPH1
• Synonyms: C6orf108; dJ330M21.3; RCL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199184, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGAGCTGGGAGCGCGGGGAGCCTGGCCGCCCGGCCCTGT
  ACTTCTGCGGGAGCATTCGCGGCGGACGCGAGGACAGGACGCTGTACGAGCGGATCGTGTCTCGGCTGCG
  GCGATTCGGGACAGTGCTCACCGAGCACGTGGCGGCCGCCGAGCTGGGCGCGCGCGGGGAAGAGGCTGCT
  GGGGGTGACAGGCTCATCCATGAGCAGGACCTGGAGTGGCTGCAGCAGGCGGACGTGGTCGTGGCAGAAG
  TGACACAGCCATCCTTGGGTGTAGGCTATGAGCTGGGCCGGGCCGTGGCCTTTAACAAGCGGATCCTGTG
  CCTGTTCCGCCCGCAGTCTGGCCGCGGTGAGCACCCCAAGCCTCCCTCCTGGCTTTCTATGGACCCAGCC
  CTCAGCTCCTTCCCTGGTGGGCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_199184
• ORF Size: 447 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199184.1, NP_954653.1
• RefSeq Size: 813
• RefSeq ORF: 447
• Locus ID: 10591
• Gene Summary: This gene was identified on the basis of its stimulation by c-Myc protein. The latter is a transcription factor that participates in the regulation of cell proliferation, differentiation, and apoptosis. The exact function of this gene is not known but studies in rat suggest a role in cellular proliferation and c-Myc-mediated transformation. Two alternative transcripts encoding different proteins have been described. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) includes an additional segment in the 3' coding region, compared to variant 1, that causes a frameshift. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1.