GDNF (NM_199231) Human Untagged Clone

CAT#: SC307904

GDNF (untagged)-Human glial cell derived neurotrophic factor (GDNF), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GDNF
• Synonyms: ATF; ATF1; ATF2; HFB1-GDNF; HSCR3
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_199231 edited
  ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGCCTTC
  CCGCTGCCCGCCGCAAATATGCCAGAGGATTATCCTGATCAGTTCGATGATGTCATGGAT
  TTTATTCAAGCCACCATTAAAAGACTGAAAAGGTCACCAGATAAACAAATGGCAGTGCTT
  CCTAGAAGAGAGCGGAATCGGCAGGCTGCAGCTGCCAACCCAGAGAATTCCAGAGGAAAA
  GGTCGGAGAGGCCAGAGGGGCAAAAACCGGGGTTGTGTCTTAACTGCAATACATTTAAAT
  GTCACTGACTTGGGTCTGGGCTATGAAACCAAGGAGGAACTGATTTTTAGGTACTGCAGC
  GGCTCTTGCGATGCAGCTGAGACAACGTACGACAAAATATTGAAAAACTTATCCAGAAAT
  AGAAGGCTGGTGAGTGACAAAGTAGGGCAGGCATGTTGCAGACCCATCGCCTTTGATGAT
  GACCTGTCGTTTTTAGATGATAACCTGGTTTACCATATTCTAAGAAAGCATTCCGCTAAA
  AGGTGTGGATGTATCTGA
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_199231 unedited
  GGTCAGCATTTGTATACGACTCCTATAGGCGGCCGCGNATTCCTGCAGCCCGGGGGATCC
  GCCCATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGC
  CTTCCCGCTGCCCGCCGCAAATATGCCAGAGGATTATCCTGATCAGTTCGATGATGTCAT
  GGATTTTATTCAAGCCACCATTAAAAGACTGAAAAGGTCACCAGATAAACAAATGGCAGT
  GCTTCCTAGAAGAGAGCGGAATCGGCAGGCTGCAGCTGCCAACCCAGAGAATTCCAGAGG
  AAAAGGTCGGAGAGGCCAGAGGGGCAAAAACCGGGGTTGTGTCTTAACTGCAATACATTT
  AAATGTCACTGACTTGGGTCTGGGCTATGAAACCAAGGAGGAACTGATTTTTAGGTACTG
  CAGCGGCTCTTGCGATGCAGCTGAGACAACGTACGACAAAATATTGAAAAACTTATCCAG
  AAATAGAAGGCTGGTGAGTGACAAAGTAGGGCAGGCATGTTGCAGACCCATCGCCTTTGA
  TGATGACCTGTCGTTTTTAGATGATAACCTGGTTTACCATATTCTAAGAAAGCATTCCGC
  TAAAAGGTGTGGATGTATCTGAGGGCTAGAGCGGCCGCGGTCATAGCTGTTTCCTGAACA
  GATCCCGGGTGGCATCCCTGTGACCCCTNCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCC
  ACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAAGTGCATCATTTTGTCTGACTAG
  GTGTCCTTCTATATATTATGGGGTGAGGGGGGTGGGATTGGAACAAAGGGCCAGNTGGGA
  AAAACACCTGTAAGGCCTGCCGGGTCTATTGGGAACAAGCTGAATTGCAGTGGCCCAATC
  TGGA
  
• Restriction Sites: Please inquire
• ACCN: NM_199231
• Insert Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_199231.1, NP_954701.1
• RefSeq Size: 681 bp
• RefSeq ORF: 558 bp
• Locus ID: 2668
• Cytogenetics: 5p13.2
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Gene Summary: 'This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]'
  Transcript Variant: This variant (2) differs in the 5' UTR, represents use of an alternate promoter, uses a downstream start codon, and uses an alternate in-frame splice site in the coding region, compared to variant 3. The resulting isoform (2) has a shorter N-terminus and lacks an internal segment, compared to isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.