MHF1 (CENPS) (NM_199294) Human Untagged Clone

CAT#: SC307926

APITD1 (untagged)-Human apoptosis-inducing, TAF9-like domain 1 (APITD1), transcript variant A

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CENPS
• Synonyms: APITD1; CENP-S; FAAP16; MHF1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199294, the custom clone sequence may differ by one or more nucleotides
  ATGGAGGAGGAGGCGGAGACCGAGGAGCAGCAGCGATTCTCTTACCAACAGAGGCTAAAG
  GCAGCAGTTCACTATACTGTGGGTTGTCTTTGCGAGGAAGTTGCATTGGACAAAGAGATG
  CAGTTCAGCAAACAGACCATTGCGGCCATTTCGGAGCTGACTTTCCGACAGTGTGAAAAT
  TTTGCCAAAGACCTTGAAATGTTTGCAAGACATGCGAAAAGAACCACAATTAACACTGAA
  GATGTGAAGCTCTTAGCCAGGAGGAGTAATTCACTGCTAAAATACATCACAGACAAAAGT
  GAAGAGATTGCTCAGATTAACCTAGAACGAAAAGCACAGAAGAAAAAGAAGTCAGAGGAT
  GGAAGCAAAAATTCAAGGCAGCCAGCAGAGGCTGGAGTGGTGGAAAGTGAGAATTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_199294
• ORF Size: 417 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199294.1, NP_954988.1
• RefSeq Size: 1251
• RefSeq ORF: 417
• Locus ID: 378708
• Gene Summary: This gene was identified in the neuroblastoma tumor suppressor candidate region on chromosome 1p36. It contains a TFIID-31 domain, similar to that found in TATA box-binding protein-associated factor, TAF(II)31, which is required for p53-mediated transcription activation. This gene was expressed at very low levels in neuroblastoma tumors, and was shown to reduce cell growth in neuroblastoma cells, suggesting that it may have a role in a cell death pathway. The protein is a component of multiple complexes, including the Fanconi anemia (FA) core complex, the APITD1/CENPS complex, and the CENPA-CAD (nucleosome distal) complex. Known functions include an involvement with chromatin associations of the FA core complex, and a role in the stable assembly of the outer kinetochore. Alternative splicing of this gene results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream cortistatin (CORT) gene, as represented in GeneID:100526739. An APITD1-related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2010]
  Transcript Variant: This variant (A) represents the shorter transcript but encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.