Claudin 8 (CLDN8) (NM_199328) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CLDN8 |
Synonyms | HEL-S-79 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_199328, the custom clone sequence may differ by one or more nucleotides
ATGGCAACCCATGCCTTAGAAATCGCTGGGCTGTTTCTTGGTGGTGTTGGAATGGTGGGCACAGTGGCTG TCACTGTCATGCCTCAGTGGAGAGTGTCGGCCTTCATTGAAAACAACATCGTGGTTTTTGAAAACTTCTG GGAAGGACTGTGGATGAATTGCGTGAGGCAGGCTAACATCAGGATGCAGTGCAAAATCTATGATTCCCTG CTGGCTCTTTCTCCGGACCTACAGGCAGCCAGAGGACTGATGTGTGCTGCTTCCGTGATGTCCTTCTTGG CTTTCATGATGGCCATCCTTGGCATGAAATGCACCAGGTGCACGGGGGACAATGAGAAGGTGAAGGCTCA CATTCTGCTGACGGCTGGAATCATCTTCATCATCACGGGCATGGTGGTGCTCATCCCTGTGAGCTGGGTT GCCAATGCCATCATCAGAGATTTCTATAACTCAATAGTGAATGTTGCCCAAAAACGTGAGCTTGGAGAAG CTCTCTACTTAGGATGGACCACGGCACTGGTGCTGATTGTTGGAGGAGCTCTGTTCTGCTGCGTTTTTTG TTGCAACGAAAAGAGCAGTAGCTACAGATACTCGATACCTTCCCATCGCACAACCCAAAAAAGTTATCAC ACCGGAAAGAAGTCACCGAGCGTCTACTCCAGAAGTCAGTATGTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_199328 |
ORF Size | 678 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_199328.2, NP_955360.1 |
RefSeq Size | 2147 |
RefSeq ORF | 678 |
Locus ID | 9073 |
Protein Families | Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
Gene Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein plays important roles in the paracellular cation barrier of the distal renal tubule, and in the paracellular barrier to prevent sodium back-leakage in distal colon. Differential expression of this gene has been observed in colorectal carcinoma and renal cell tumors, and along with claudin-7, is an immunohistochemical marker for the differential diagnosis of chromophobe renal cell carcinoma and renal oncocytoma. [provided by RefSeq, May 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC320974 | CLDN8 (untagged)-Human claudin 8 (CLDN8) |
USD 420.00 |
|
RC208853 | CLDN8 (Myc-DDK-tagged)-Human claudin 8 (CLDN8) |
USD 98.00 |
|
RG208853 | CLDN8 (GFP-tagged) - Human claudin 8 (CLDN8) |
USD 460.00 |
|
RC208853L1 | Lenti ORF clone of Human claudin 8 (CLDN8), Myc-DDK-tagged |
USD 768.00 |
|
RC208853L2 | Lenti ORF clone of Human claudin 8 (CLDN8), mGFP tagged |
USD 620.00 |
|
RC208853L3 | Lenti ORF clone of Human claudin 8 (CLDN8), Myc-DDK-tagged |
USD 620.00 |
|
RC208853L4 | Lenti ORF clone of Human claudin 8 (CLDN8), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review