PRB1 (NM_199353) Human Untagged Clone
CAT#: SC307952
PRB1 (untagged)-Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 2
"NM_199353" in other vectors (2)
Product Images
Other products for "PRB1"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | PRB1 |
| Synonyms | PM; PMF; PMS; PRB1L; PRB1M |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_199353, the custom clone sequence may differ by one or more nucleotides
ATGCTGTTGATTCTGCTGTCAGTGGCCTTGCTGGCCCTGAGCTCAGCTCAGAACTTAAAT GAAGATGTCAGCCAGGAAGAATCTCCCTCCCTAATAGCAGGAAATCCACAAGGACCATCC CCACAAGGAGGCAACAAGCCCCAGGGCCCCCCACCTCCTCCAGGAAAGCCACAAGGACCA CCCCCACAAGGAGGCAACAAACCTCAAGGTCCCCCACCTCCAGGAAAGCCACAAGGACCA CCCCCACAAGGGGACAAGTCCCGAAGTCCCCGATCTCCTCCAGGAAAACCACAAGGACCA CCCCCACAAGGAGGAAAGCCACAAGGACCACCCCCACAAGGAGGCAACAAACCTCAAGGT CCCCCACCTCCAGGAAAGCCACAAGGACCACCCGCACAAGGAGGCAGCAAGTCCCAAAGT GCCCGATCTCCTCCAGGAAAGCCACAAGGACCACCCCAACAAGAAGGCAACAATCCTCAA GGTCCCCCACCTCCAGCAGGAGGCAATCCCCAGCAGCCTCAGGCACCTCCTGCTGGACAG CCCCAGGGACCACCACGCCCTCCTCAAGGGGGCAGACCTTCCAGACCTCCCCAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_199353 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_199353.1, NP_955385.1 |
| RefSeq Size | 774 bp |
| RefSeq ORF | 774 bp |
| Locus ID | 5542 |
| Cytogenetics | 12p13.2 |
| Protein Families | Druggable Genome |
| Gene Summary | 'This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats have been identified. The reference genome encodes the "Medium" allele. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]' Transcript Variant: This variant (2) lacks an in-frame segment within the coding region compared to variant 1. The resulting isoform (2) lacks an internal region, as compared to isoform 1. This isoform (2) may undergo proteolytic processing similar to isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China