WWP2 (NM_199423) Human Untagged Clone

CAT#: SC307968

WWP2 (untagged)-Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WWP2
• Synonyms: AIP2; WWp2-like
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199423, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCATCTGCCAGCTCTAGCCGGGCAGGAGTGGCCCTGCCTTTTGAGAAGTCTCAGCTCACTTTGAAAG
  TGGTGTCCGCAAAGCCCAAGGTGCATAATCGTCAACCTCGAATTAACTCCTACGTGGAGGTGGCGGTGGA
  TGGACTCCCCAGTGAGACCAAGAAGACTGGGAAGCGCATTGGGAGCTCTGAGCTTCTCTGGAATGAGATC
  ATCATTTTGAATGTCACGGCACAGAGTCATTTAGATTTAAAGGTCTGGAGCTGCCATACCTTGAGAAATG
  AACTGCTAGGCACCGCATCTGTCAACCTCTCCAACGTCTTGAAGAACAATGGGGGCAAAATGGAGAACAT
  GCAGCTGACCCTGAACCTGCAGACGGAGAACAAAGGCAGCGTTGTCTCAGGCGGAGAGCTGACAATTTTC
  CTGGACGGGCCAACTGTTGATCTGGGAAATGTGCCTAATGGCAGTGCCCTGACAGATGGATCACAGCTGC
  CTTCGAGAGACTCCAGTGGAACAGCAGTAGCTCCAGAGAACCGGCACCAGCCCCCCAGCACAAACTGCTT
  TGGTGGAAGATCCCGGACGCACAGACATTCGGGTGCTTCAGCCAGAACAACCCCAGCAACCGGCGAGCAA
  AGCCCCGGTGCTCGGAGCCGGCACCGCCAGCCCGTCAAGAACTCAGGCCACAGTGGCTTGGCCAATGGCA
  CAGTGAATGATGAACCCACAACAGCCACTGATCCCGAAGAACCTTCCGTTGTTGGTGTGACGTCCCCACC
  TGCTGCACCCTTGAGTGTGACCCCGAATCCCAACACGACTTCTCTCCCTGCCCCAGCCACACCGGCTGAA
  GGAGAGGAACCCAGCACTTCGGGTACACAGCAGCTCCCAGCGGCTGCCCAGGCCCCCGACGCTCTGCCTG
  CTGGATGGGAACAGCGAGAGCTGCCCAACGGACGTGTCTATTATGTTGACCACAATACCAAGACCACCAC
  CTGGGAGCGGCCCCTTCCTCCAGGGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_199423
• ORF Size: 1008 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199423.1, NP_955455.1
• RefSeq Size: 2659
• RefSeq ORF: 1008
• Locus ID: 11060
• Protein Families: Druggable Genome
• Protein Pathways: Ubiquitin mediated proteolysis
• Gene Summary: This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (3) lacks several 3' exons but has an alternate and much shorter 3' end, as compared to variant 1. The encoded isoform 3 is 3' truncated and thus lacks three WW domains and a HECT domain in the C-terminal region, as compared to isoform 1.