Hsp60 (HSPD1) (NM_199440) Human Untagged Clone
CAT#: SC307976
HSPD1 (untagged)-Human heat shock 60kDa protein 1 (chaperonin) (HSPD1), nuclear gene encoding mitochondrial protein, transcript variant 2
"NM_199440" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HSPD1 |
Synonyms | CPN60; GROEL; HLD4; HSP-60; HSP60; HSP65; HuCHA60; SPG13 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_199440, the custom clone sequence may differ by one or more nucleotides
ATGCTTCGGTTACCCACAGTCTTTCGCCAGATGAGACCGGTGTCCAGGGTACTGGCTCCTCATCTCACTC GGGCTTATGCCAAAGATGTAAAATTTGGTGCAGATGCCCGAGCCTTAATGCTTCAAGGTGTAGACCTTTT AGCCGATGCTGTGGCCGTTACAATGGGGCCAAAGGGAAGAACAGTGATTATTGAGCAGAGTTGGGGAAGT CCCAAAGTAACAAAAGATGGTGTGACTGTTGCAAAGTCAATTGACTTAAAAGATAAATACAAAAACATTG GAGCTAAACTTGTTCAAGATGTTGCCAATAACACAAATGAAGAAGCTGGGGATGGCACTACCACTGCTAC TGTACTGGCACGCTCTATAGCCAAGGAAGGCTTCGAGAAGATTAGCAAAGGTGCTAATCCAGTGGAAATC AGGAGAGGTGTGATGTTAGCTGTTGATGCTGTAATTGCTGAACTTAAAAAGCAGTCTAAACCTGTGACCA CCCCTGAAGAAATTGCACAGGTTGCTACGATTTCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTC TGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGATGGAAAAACACTGAATGATGAA TTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAG GTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCAT TGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGA GAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAG GGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGA AGAGGGATTGACCCTGAATCTTGAAGACGTTCAGCCTCATGACTTAGGAAAAGTTGGAGAGGTCATTGTG ACCAAAGACGATGCCATGCTCTTAAAAGGAAAAGGTGACAAGGCTCAAATTGAAAAACGTATTCAAGAAA TCATTGAGCAGTTAGATGTCACAACTAGTGAATATGAAAAGGAAAAACTGAATGAACGGCTTGCAAAACT TTCAGATGGAGTGGCTGTGCTGAAGGTTGGTGGGACAAGTGATGTTGAAGTGAATGAAAAGAAAGACAGA GTTACAGATGCCCTTAATGCTACAAGAGCTGCTGTTGAAGAAGGCATTGTTTTGGGAGGGGGTTGTGCCC TCCTTCGATGCATTCCAGCCTTGGACTCATTGACTCCAGCTAATGAAGATCAAAAAATTGGTATAGAAAT TATTAAAAGAACACTCAAAATTCCAGCAATGACCATTGCTAAGAATGCAGGTGTTGAAGGATCTTTGATA GTTGAGAAAATTATGCAAAGTTCCTCAGAAGTTGGTTATGATGCTATGGCTGGAGATTTTGTGAATATGG TGGAAAAAGGAATCATTGACCCAACAAAGGTTGTGAGAACTGCTTTATTGGATGCTGCTGGTGTGGCCTC TCTGTTAACTACAGCAGAAGTTGTAGTCACAGAAATTCCTAAAGAAGAGAAGGACCCTGGAATGGGTGCA ATGGGTGGAATGGGAGGTGGTATGGGAGGTGGCATGTTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_199440 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_199440.1, NP_955472.1 |
RefSeq Size | 2319 bp |
RefSeq ORF | 1722 bp |
Locus ID | 3329 |
Cytogenetics | 2q33.1 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | RNA degradation, Type I diabetes mellitus |
Gene Summary | 'This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13. [provided by RefSeq, Jun 2010]' Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201281 | HSPD1 (Myc-DDK-tagged)-Human heat shock 60kDa protein 1 (chaperonin) (HSPD1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 480.00 |
|
RG201281 | HSPD1 (GFP-tagged) - Human heat shock 60kDa protein 1 (chaperonin) (HSPD1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 530.00 |
|
RC201281L1 | Lenti ORF clone of Human heat shock 60kDa protein 1 (chaperonin) (HSPD1), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
USD 840.00 |
|
RC201281L2 | Lenti ORF clone of Human heat shock 60kDa protein 1 (chaperonin) (HSPD1), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
USD 680.00 |
|
RC201281L3 | Lenti ORF clone of Human heat shock 60kDa protein 1 (chaperonin) (HSPD1), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
USD 680.00 |
|
RC201281L4 | Lenti ORF clone of Human heat shock 60kDa protein 1 (chaperonin) (HSPD1), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review