DNAJC12 (NM_201262) Human Untagged Clone
CAT#: SC308000
DNAJC12 (untagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 12 (DNAJC12), transcript variant 2
"NM_201262" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DNAJC12 |
Synonyms | HPANBH4; JDP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_201262, the custom clone sequence may differ by one or more nucleotides
ATGGATGCAATACTGAATTACAGGTCAGAAGATACTGAAGATTACTACACATTACTGGGATGTGATGAAC TATCTTCGGTTGAACAAATCCTGGCAGAATTTAAAGTCAGAGCTCTGGAATGTCACCCAGACAAGCATCC TGAAAACCCCAAAGCTGTGGAGACTTTTCAGAAACTGCAGAAGGCAAAGGAGATTCTGACCAATGAAGAG AGTCGAGCCCGCTATGACCACTGGCGAAGGAGCCAGATGTCGATGCCATTCCAGCAGTGGGAAGCTTTGA ATGACTCAGTGAAGACGGTGGGTTTCTCGCTGGGTGCGACGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_201262 |
ORF Size | 324 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_201262.1, NP_957714.1 |
RefSeq Size | 786 |
RefSeq ORF | 324 |
Locus ID | 56521 |
Gene Summary | This gene encodes a member of a subclass of the HSP40/DnaJ protein family. Members of this family of proteins are associated with complex assembly, protein folding, and export. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 3' UTR and has multiple coding region differences compared to variant 1. The resulting isoform (b) contains a shorter and distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215035 | DNAJC12 (Myc-DDK-tagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 12 (DNAJC12), transcript variant 2 |
USD 98.00 |
|
RG215035 | DNAJC12 (GFP-tagged) - Human DnaJ (Hsp40) homolog, subfamily C, member 12 (DNAJC12), transcript variant 2 |
USD 460.00 |
|
RC215035L3 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 12 (DNAJC12), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC215035L4 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 12 (DNAJC12), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review