WARS2 (NM_201263) Human Untagged Clone

CAT#: SC308001

WARS2 (untagged)-Human tryptophanyl tRNA synthetase 2, mitochondrial (WARS2), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WARS2
• Synonyms: mtTrpRS; NEMMLAS; TrpRS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_201263, the custom clone sequence may differ by one or more nucleotides
  ATGGCGCTGCACTCAATGCGGAAAGCGCGTGAGCGCTGGAGCTTCATCCGGGCACTTCAT
  AAGGGATCCGCAGCTGCTCCCGCTCTCCAGAAAGACAGCAAGAAGCGAGTATTTTCCGGC
  ATTCAACCTACAGGAATCCTCCACCTGGGCAATTACCTGGGAGCCATTGAGAGCTGGGTG
  AGGTTACAGGATGAATATGACTCTGTATTATACAGCATTGTTGACCTCCACTCCATTACT
  GTCCCCCAAGACCCAGCTGTCCTTCGGCAGAGCATCCTGGACATGACTGCTGTTCTTCTT
  GCCTGTGGCATAAACCCGGAAAAAAGCATCCTTTTCCAACAATCTCAGGTGTCTGAACAC
  ACACAATTAAGTTGGATCCTTTCCTGCATGGTCAGACTACCTCGATTACAACATTTACAT
  CAGTGGAAGGCAAAGACTACCAAGCAGAAGCACGATGGCACGGTGGGCCTGCTCACATAC
  CCAGTACTCCAGGCAGCCGACATTCTGTTGTACAAGTCCACACACGTTCCTGTTGGGGAG
  GATCAAGTCCAGCACATGGAACTAGTTCAGGATCTAGCACAAGGTTTCAACAAGAAGTAT
  GGGGAGTTCTTTCCAGTGCCCGAGTCCATTCTCAGTATGTGTGTGTTGGTGTTTTTAACC
  TAG
  
• Restriction Sites: Please inquire
• ACCN: NM_201263
• ORF Size: 2835 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_201263.1, NP_957715.1
• RefSeq Size: 2875
• RefSeq ORF: 2835
• Locus ID: 10352
• Protein Families: Druggable Genome
• Protein Pathways: Aminoacyl-tRNA biosynthesis, Tryptophan metabolism
• Gene Summary: Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. This gene encodes the mitochondrial tryptophanyl-tRNA synthetase. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) includes an alternate in-frame segment in the 3' coding region, compared to variant 1, that causes a frameshift. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1.