H2AFV (NM_201516) Human Untagged Clone

CAT#: SC308039

H2AFV (untagged)-Human H2A histone family, member V (H2AFV), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: H2AFV
• Synonyms: H2A.Z-2; H2AV
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_201516, the custom clone sequence may differ by one or more nucleotides
  ATGGCTGGAGGCAAAGCTGGAAAGGACAGTGGGAAGGCCAAGGCTAAGGCAGTATCTCGC
  TCACAGAGAGCTGGGCTACAGTTTCCTGTGGGCCGCATCCACAGACACTTGAAGACTCGC
  ACCACAAGCCATGGAAGGGTGGGTGCCACTGCTGCCGTGTACAGTGCTGCGATTCTGGAG
  TACCTCACTGCAGAGGTGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_201516
• ORF Size: 201 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_201516.1, NP_958924.1
• RefSeq Size: 1023
• RefSeq ORF: 201
• Locus ID: 94239
• Protein Families: Druggable Genome
• Protein Pathways: Systemic lupus erythematosus
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. Several transcript variants encoding different isoforms, have been identified for this gene. [provided by RefSeq, Oct 2015]
  Transcript Variant: This variant (4) lacks a 3' exon in the coding region, compared to variant 1. This results in a shorter protein (isoform 4) compared to isoform 1.