Galectin 8 (LGALS8) (NM_201544) Human Untagged Clone

CAT#: SC308048

LGALS8 (untagged)-Human lectin, galactoside-binding, soluble, 8 (LGALS8), transcript variant 3


  "NM_201544" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LGALS8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LGALS8
Synonyms Gal-8; PCTA-1; PCTA1; Po66-CBP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_201544, the custom clone sequence may differ by one or more nucleotides


ATGATGTTGTCCTTAAACAACCTACAGAATATCATCTATAACCCGGTAATCCCGTTTGTTGGCACCATTC
CTGATCAGCTGGATCCTGGAACTTTGATTGTGATACGTGGGCATGTTCCTAGTGACGCAGACAGATTCCA
GGTGGATCTGCAGAATGGCAGCAGCATGAAACCTCGAGCCGATGTGGCCTTTCATTTCAATCCTCGTTTC
AAAAGGGCCGGCTGCATTGTTTGCAATACTTTGATAAATGAAAAATGGGGACGGGAAGAGATCACCTATG
ACACGCCTTTCAAAAGAGAAAAGTCTTTTGAGATCGTGATTATGGTGCTGAAGGACAAATTCCAGGTGGC
TGTAAATGGAAAACATACTCTGCTCTATGGCCACAGGATCGGCCCAGAGAAAATAGACACTCTGGGCATT
TATGGCAAAGTGAATATTCACTCAATTGGTTTTAGCTTCAGCTCGGACTTACAAAGTACCCAAGCATCTA
GTCTGGAACTGACAGAGATAAGTAGAGAAAATGTTCCAAAGTCTGGCACGCCCCAGCTTAGGCTGCCATT
CGCTGCAAGGTTGAACACCCCCATGGGCCCTGGACGAACTGTCGTCGTTAAAGGAGAAGTGAATGCAAAT
GCCAAAAGCTTTAATGTTGACCTACTAGCAGGAAAATCAAAGGATATTGCTCTACACTTGAACCCACGCC
TGAATATTAAAGCATTTGTAAGAAATTCTTTTCTTCAGGAGTCCTGGGGAGAAGAAGAGAGAAATATTAC
CTCTTTCCCATTTAGTCCTGGGATGTACTTTGAGATGATAATTTATTGTGATGTTAGAGAATTCAAGGTT
GCAGTAAATGGCGTACACAGCCTGGAGTACAAACACAGATTTAAAGAGCTCAGCAGTATTGACACGCTGG
AAATTAATGGAGACATCCACTTACTGGAAGTAAGGAGCTGGTAG


Restriction Sites SgfI-MluI     
ACCN NM_201544
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_201544.2, NP_963838.1
RefSeq Size 6212 bp
RefSeq ORF 954 bp
Locus ID 3964
Cytogenetics 1q43
Gene Summary 'This gene encodes a member of the galectin family. Galectins are beta-galactoside-binding animal lectins with conserved carbohydrate recognition domains. The galectins have been implicated in many essential functions including development, differentiation, cell-cell adhesion, cell-matrix interaction, growth regulation, apoptosis, and RNA splicing. This gene is widely expressed in tumoral tissues and seems to be involved in integrin-like cell interactions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an in-frame segment of the coding region, compared to variant 1. Variants 2 and 3 encode a shorter isoform (b) that is missing an internal segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS representation uses the 5'-most in-frame start codon, which is conserved in higher primates. An alternative downstream start codon, which is more widely conserved, also exists. It is possible that leaky scanning by ribosomes would allow the downstream start codon to be used, at least some of the time. The use of the downstream start codon would result in a protein that is 1 aa shorter at the N-terminus. There is no experimental evidence showing which start codon is preferentially used in vivo.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.