SLC28A1 (NM_201651) Human Untagged Clone

CAT#: SC308085

SLC28A1 (untagged)-Human solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 (SLC28A1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC28A1
• Synonyms: CNT1; HCNT1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_201651 edited
  AAGGCAAGCCAGAGCCAAAGCAGGTTGGACCCAGCTTGTCCCCACAGAGACGTGTGCTTC
  CCTCTCTCTCTGAGAGCGACCTGTTAACCGCAAATACCTGGAAGGTCTGGGACATGGAGA
  ACGACCCCTCGAGACGAAGAGAGTCCATCTCTCTCACACCTGTGGCCAAGGGTCTGGAGA
  ACATGGGGGCTGATTTCTTGGAAAGCCTGGAGGAAGGCCAGCTCCCTAGGAGTGACTTGA
  GCCCCGCAGAGATCAGGAGCAGCTGGAGCGAGGCGGCGCCGAAGCCCTTCTCCAGATGGA
  GGAACCTGCAGCCAGCCCTGAGAGCCAGAAGCTTCTGCAGGGAGCACATGCAGCTGTTTC
  GATGGATCGGCACAGGCCTGCTCTGCACTGGGCTCTCTGCCTTCCTGCTGGTGGCCTGCC
  TCCTGGATTTCCAGAGGGCCCTGGCTCTGTTTGTCCTCACCTGTGTGGTCCTCACCTTCC
  TGGGCCACCGCCTGCTGAAACGGCTTCTGGGGCCAAAGCTGAGGAGGTTTCTCAAGCCTC
  AGGGCCATCCCCGCCTGCTGCTCTGGTTTAAGAGGGATCCCAGGCCATGGAGCAAGGAGG
  GCCCGAATCAGTACCTCCCTCAGATCACCTGGACAGTGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_201651
• ORF Size: 528 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_201651.1, NP_964014.1
• RefSeq Size: 1339
• RefSeq ORF: 528
• Locus ID: 9154
• Protein Families: Transmembrane
• Gene Summary: Sodium-dependent and pyrimidine-selective. Exhibits the transport characteristics of the nucleoside transport system cit or N2 subtype (N2/cit) (selective for pyrimidine nucleosides and adenosine). It also transports the antiviral pyrimidine nucleoside analogs 3'-azido-3'-deoxythymidine (AZT) and 2',3'-dideoxycytidine (ddC). It may be involved in the intestinal absorption and renal handling of pyrimidine nucleoside analogs used to treat acquired immunodeficiency syndrome (AIDS). It has the following selective inhibition: adenosine, thymidine, cytidine, uridine >> guanosine, inosine. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1.