GRB2 (NM_203506) Human Untagged Clone

CAT#: SC308219

GRB2 (untagged)-Human growth factor receptor-bound protein 2 (GRB2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GRB2
• Synonyms: ASH; EGFRBP-GRB2; Grb3-3; MST084; MSTP084; NCKAP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_203506, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAGCCATCGCCAAATATGACTTCAAAGCTACTGCAGACGACGAGCTGAGCTTCAAAAGGGGGGACA
  TCCTCAAGGTTTTGAACGAAGAATGTGATCAGAACTGGTACAAGGCAGAGCTTAATGGAAAAGACGGCTT
  CATTCCCAAGAACTACATAGAAATGAAACCACATCCGTTTGGAAACGATGTGCAGCACTTCAAGGTGCTC
  CGAGATGGAGCCGGGAAGTACTTCCTCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTGGATTATC
  ACAGATCTACATCTGTCTCCAGAAACCAGCAGATATTCCTGCGGGACATAGAACAGGTGCCACAGCAGCC
  GACATACGTCCAGGCCCTCTTTGACTTTGATCCCCAGGAGGATGGAGAGCTGGGCTTCCGCCGGGGAGAT
  TTTATCCATGTCATGGATAACTCAGACCCCAACTGGTGGAAAGGAGCTTGCCACGGGCAGACCGGCATGT
  TTCCCCGCAATTATGTCACCCCCGTGAACCGGAACGTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_203506
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_203506.2, NP_987102.1
• RefSeq Size: 3181 bp
• RefSeq ORF: 531 bp
• Locus ID: 2885
• Cytogenetics: 17q25.1
• Protein Families: Druggable Genome
• Protein Pathways: Acute myeloid leukemia, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Dorso-ventral axis formation, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Insulin signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pathways in cancer, Prostate cancer, Renal cell carcinoma, T cell receptor signaling pathway
• Gene Summary: 'The protein encoded by this gene binds the epidermal growth factor receptor and contains one SH2 domain and two SH3 domains. Its two SH3 domains direct complex formation with proline-rich regions of other proteins, and its SH2 domain binds tyrosine phosphorylated sequences. This gene is similar to the Sem5 gene of C.elegans, which is involved in the signal transduction pathway. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, as compared to variant 1. It encodes the shorter isoform (2) that lacks an internal segment, as compared to isoform 1.