LST1 (NM_205839) Human Untagged Clone
CAT#: SC308229
LST1 (untagged)-Human leukocyte specific transcript 1 (LST1), transcript variant 4
"NM_205839" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LST1 |
Synonyms | B144; D6S49E; LST-1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_205839, the custom clone sequence may differ by one or more nucleotides
ATGTTATCGCGGAATGATGATATATGTATCTACGGGGGCCTGGGGCTGGGCGGGCTCCTG CTTCTGGCAGTGGTCCTTCTGTCCGCCTGCCTGTGTTGGCTGCATCGAAGAGTAAAGAGG CTGGAGAGGAGCTGGGCCCAGGGCTCCTCAGAGCAGGAACTCCACTATGCATCTCTGCAG AGGCTGCCAGTGCCCAGCAGTGAGGGACCTGACCTCAGGGGCAGAGACAAGAGAGGCACC AAGGAGGATCCAAGAGCTGACTATGCCTGCATTGCTGAGAACAAACCCACCTGA |
Restriction Sites | Please inquire |
ACCN | NM_205839 |
ORF Size | 192 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_205839.1, NP_995311.1 |
RefSeq Size | 650 |
RefSeq ORF | 192 |
Locus ID | 7940 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a membrane protein that can inhibit the proliferation of lymphocytes. Expression of this gene is enhanced by lipopolysaccharide, interferon-gamma, and bacteria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (4) includes an additional exon in the 5' UTR and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (4) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213326 | LST1 (Myc-DDK-tagged)-Human leukocyte specific transcript 1 (LST1), transcript variant 4 |
USD 420.00 |
|
RG213326 | LST1 (GFP-tagged) - Human leukocyte specific transcript 1 (LST1), transcript variant 4 |
USD 460.00 |
|
RC213326L3 | Lenti-ORF clone of LST1 (Myc-DDK-tagged)-Human leukocyte specific transcript 1 (LST1), transcript variant 4 |
USD 620.00 |
|
RC213326L4 | Lenti-ORF clone of LST1 (mGFP-tagged)-Human leukocyte specific transcript 1 (LST1), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review