LST1 (NM_205839) Human Untagged Clone

CAT#: SC308229

LST1 (untagged)-Human leukocyte specific transcript 1 (LST1), transcript variant 4


  "NM_205839" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "LST1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LST1
Synonyms B144; D6S49E; LST-1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_205839, the custom clone sequence may differ by one or more nucleotides
ATGTTATCGCGGAATGATGATATATGTATCTACGGGGGCCTGGGGCTGGGCGGGCTCCTG
CTTCTGGCAGTGGTCCTTCTGTCCGCCTGCCTGTGTTGGCTGCATCGAAGAGTAAAGAGG
CTGGAGAGGAGCTGGGCCCAGGGCTCCTCAGAGCAGGAACTCCACTATGCATCTCTGCAG
AGGCTGCCAGTGCCCAGCAGTGAGGGACCTGACCTCAGGGGCAGAGACAAGAGAGGCACC
AAGGAGGATCCAAGAGCTGACTATGCCTGCATTGCTGAGAACAAACCCACCTGA
Restriction Sites Please inquire     
ACCN NM_205839
ORF Size 192 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_205839.1, NP_995311.1
RefSeq Size 650
RefSeq ORF 192
Locus ID 7940
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a membrane protein that can inhibit the proliferation of lymphocytes. Expression of this gene is enhanced by lipopolysaccharide, interferon-gamma, and bacteria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4) includes an additional exon in the 5' UTR and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (4) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.