Reticulon 1 (RTN1) (NM_206852) Human Untagged Clone

CAT#: SC308284

RTN1 (untagged)-Human reticulon 1 (RTN1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RTN1
• Synonyms: NSP
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_206852 edited
  ATGCAGGCCACTGCCGATTCCACCAAGATGGACTGTGTGTGGAGCAACTGGAAAAGTCAG
  GCTATTGACCTGTTGTATTGGCGGGACATCAAGCAGACGGGCATCGTGTTTGGGAGTTTC
  CTGCTGCTGCTCTTCTCCCTGACCCAGTTCAGCGTGGTGAGCGTCGTGGCCTACCTGGCC
  CTGGCCGCACTCTCAGCCACCATCAGTTTCCGCATCTACAAGTCTGTTTTACAAGCAGTG
  CAGAAAACCGACGAAGGCCACCCTTTCAAGGCCTACTTGGAGCTTGAGATCACCCTTTCT
  CAGGAGCAGATTCAGAAGTACACGGACTGCCTGCAGTTCTACGTGAACAGCACACTTAAG
  GAACTGAGGAGGCTCTTCCTTGTCCAGGACCTGGTGGATTCCTTAAAATTTGCAGTCCTG
  ATGTGGCTCCTGACCTACGTTGGCGCTCTCTTCAATGGCCTGACCCTGCTGCTCATGGCT
  GTGGTTTCAATGTTTACTCTACCTGTAGTGTATGTTAAGCACCAGGCACAGATTGACCAA
  TATCTGGGACTTGTGAGGACTCACATAAATGCTGTTGTGGCAAAGATTCAGGCTAAAATC
  CCAGGCGCTAAGAGGCACGCTGAGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_206852
• Insert Size: 2000 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_206852.1, NP_996734.1
• RefSeq Size: 1710 bp
• RefSeq ORF: 627 bp
• Locus ID: 6252
• Cytogenetics: 14q23.1
• Protein Families: Transmembrane
• Gene Summary: 'This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]'
  Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (C, also known as NSP-C) contains a distinct N-terminus and is shorter than isoform A.