QK1 (QKI) (NM_206853) Human Untagged Clone

CAT#: SC308285

QKI (untagged)-Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: QKI
• Synonyms: Hqk; hqkI; QK; QK1; QK3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_206853, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTCGGGGAAATGGAAACGAAGGAGAAGCCGAAGCCCACCCCAGATTACCTGATGCAGCTGATGAACG
  ACAAGAAGCTCATGAGCAGCCTGCCCAACTTCTGCGGGATCTTCAACCACCTCGAGCGGCTGCTGGACGA
  AGAAATTAGCAGAGTACGGAAAGACATGTACAATGACACATTAAATGGCAGTACAGAGAAAAGGAGTGCA
  GAATTGCCTGATGCTGTGGGACCTATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACC
  CAGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCAGAAAC
  CGGATGTAAAATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAATAGAGGC
  AAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCTCAGAACAGAG
  CAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTACCTGCAGCAGAAGGAGAAGA
  CAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTGAATGGCACCTACAGAGATGCCAACATTAAA
  TCACCAGCCCTTGCCTTTTCTCTTGCAGCAACAGCCCAGGCTGCTCCAAGGATCATTACTGGGCCTGCGC
  CGGTTCTCCCACCAGCTGCCCTGCGTACTCCTACGCCAGCTGGCCCTACCATAATGCCTTTGATCAGACA
  AATACAGACCGCTGTCATGCCAAACGGAACTCCTCACCCAACTGCTGCAATAGTTCCTCCAGGGCCCGAA
  GCTGGTTTAATCTATACACCCTATGAGTACCCCTACACATTGGCACCAGCTACATCAATCCTTGAGTATC
  CTATTGAACCTAGTGGTGTATTAGGTATGGCTTTCCCAACGAAAGGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_206853
• ORF Size: 960 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_206853.2, NP_996735.1
• RefSeq Size: 14152
• RefSeq ORF: 960
• Locus ID: 9444
• Gene Summary: The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1, which results in a frameshift. The resulting isoform (2; also known as HQK-6 and QKI-6) is shorter and has a distinct C-terminus compared to isoform 1. Isoforms 2 and 4 are the same length but have different C-termini. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.