QK1 (QKI) (NM_206855) Human Untagged Clone

CAT#: SC308287

QKI (untagged)-Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 4


  "NM_206855" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol QKI
Synonyms Hqk; hqkI; QK; QK1; QK3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_206855, the custom clone sequence may differ by one or more nucleotides


ATGGTCGGGGAAATGGAAACGAAGGAGAAGCCGAAGCCCACCCCAGATTACCTGATGCAGCTGATGAACG
ACAAGAAGCTCATGAGCAGCCTGCCCAACTTCTGCGGGATCTTCAACCACCTCGAGCGGCTGCTGGACGA
AGAAATTAGCAGAGTACGGAAAGACATGTACAATGACACATTAAATGGCAGTACAGAGAAAAGGAGTGCA
GAATTGCCTGATGCTGTGGGACCTATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACC
CAGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCAGAAAC
CGGATGTAAAATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAATAGAGGC
AAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCTCAGAACAGAG
CAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTACCTGCAGCAGAAGGAGAAGA
CAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTGAATGGCACCTACAGAGATGCCAACATTAAA
TCACCAGCCCTTGCCTTTTCTCTTGCAGCAACAGCCCAGGCTGCTCCAAGGATCATTACTGGGCCTGCGC
CGGTTCTCCCACCAGCTGCCCTGCGTACTCCTACGCCAGCTGGCCCTACCATAATGCCTTTGATCAGACA
AATACAGACCGCTGTCATGCCAAACGGAACTCCTCACCCAACTGCTGCAATAGTTCCTCCAGGGCCCGAA
GCTGGTTTAATCTATACACCCTATGAGTACCCCTACACATTGGCACCAGCTACATCAATCCTTGAGTATC
CTATTGAACCTAGTGGTGTATTAGGTAAGTTCTTCTCCCCATGGGGTTAA


Restriction Sites SgfI-MluI     
ACCN NM_206855
ORF Size 960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_206855.2, NP_996737.1
RefSeq Size 16378
RefSeq ORF 960
Locus ID 9444
Gene Summary The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) differs in the 3' UTR and coding region compared to variant 1, which results in a frameshift. The resulting isoform (4; also known as HQK-7B and QKI-7b) is shorter and has a distinct C-terminus compared to isoform 1. Isoforms 2 and 4 are the same length but have different C-termini. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.