ARL9 (NM_206919) Human Untagged Clone

CAT#: SC308320

ARL9 (untagged)-Human ADP-ribosylation factor-like 9 (ARL9)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARL9
• Synonyms: ADP-ribosylation factor-like 9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_206919, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGTTCCTGGAGATTGGTGGCAGTAAACCTTTTCGGTCCTACTGGGAAATGTACCTATCCAAGGGAT
  TGCTGCTGATCTTTGTGGTGGATTCAGCAGATCACAGCCGATTACCTGAAGCCAAGAAATACCTTCATCA
  GCTAATTGCAGCAAACCCAGTACTTCCTCTGGTTGTGTTTGCAAACAAACAGGATCTTGAAGCAGCCTAT
  CACATTACAGATATCCATGAAGCTTTGGCATTATCTGAAGTGGGAAATGACAGGAAGATGTTCTTGTTTG
  GAACCTACCTGACTAAGAATGGCTCAGAGATACCCTCCACCATGCAAGATGCCAAAGACTTGATTGCACA
  GCTGGCTGCAGATGTGCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_206919
• ORF Size: 372 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_206919.1, NP_996802.1
• RefSeq Size: 836
• RefSeq ORF: 372
• Locus ID: 132946
• Gene Summary: ARL9 is a member of the small GTPase protein family with a high degree of similarity to ARF (MIM 103180) proteins of the RAS superfamily. [supplied by OMIM, Nov 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.