CA12 (NM_206925) Human Untagged Clone

CAT#: SC308325

CA12 (untagged)-Human carbonic anhydrase XII (CA12), transcript variant 2


  "NM_206925" in other vectors (5)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CA12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CA12
Synonyms CA-XII; CAXII; HsT18816; T18816
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_206925, the custom clone sequence may differ by one or more nucleotides


ATGCCCCGGCGCAGCCTGCACGCGGCGGCCGTGCTCCTGCTGGTGATCTTAAAGGAACAGCCTTCCAGCC
CGGCCCCAGTGAACGGTTCCAAGTGGACTTATTTTGGTCCTGATGGGGAGAATAGCTGGTCCAAGAAGTA
CCCGTCGTGTGGGGGCCTGCTGCAGTCCCCCATAGACCTGCACAGTGACATCCTCCAGTATGACGCCAGC
CTCACGCCCCTCGAGTTCCAAGGCTACAATCTGTCTGCCAACAAGCAGTTTCTCCTGACCAACAATGGCC
ATTCAGTGAAGCTGAACCTGCCCTCGGACATGCACATCCAGGGCCTCCAGTCTCGCTACAGTGCCACGCA
GCTGCACCTGCACTGGGGGAACCCGAATGACCCGCACGGCTCTGAGCACACCGTCAGCGGACAGCACTTC
GCCGCCGAGCTGCACATTGTCCATTATAACTCAGACCTTTATCCTGACGCCAGCACTGCCAGCAACAAGT
CAGAAGGCCTCGCTGTCCTGGCTGTTCTCATTGAGATGGGCTCCTTCAATCCGTCCTATGACAAGATCTT
CAGTCACCTTCAACATGTAAAGTACAAAGGCCAGGAAGCATTCGTCCCGGGATTCAACATTGAAGAGCTG
CTTCCGGAGAGGACCGCTGAATATTACCGCTACCGGGGGTCCCTGACCACACCCCCTTGCAACCCCACTG
TGCTCTGGACAGTTTTCCGAAACCCCGTGCAAATTTCCCAGGAGCAGCTGCTGGCTTTGGAGACAGCCCT
GTACTGCACACACATGGACGACCCTTCCCCCAGAGAAATGATCAACAACTTCCGGCAGGTCCAGAAGTTC
GATGAGAGGCTGGTATACACCTCCTTCTCCCAAGGCATCATCCTCTCACTGGCCCTGGCTGGCATTCTTG
GCATCTGTATTGTGGTGGTGGTGTCCATTTGGCTTTTCAGAAGGAAGAGTATCAAAAAAGGTGATAACAA
GGGAGTCATTTACAAGCCAGCCACCAAGATGGAGACTGAGGCCCACGCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_206925
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_206925.2, NP_996808.1
RefSeq Size 4176 bp
RefSeq ORF 1032 bp
Locus ID 771
Cytogenetics 15q22.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways Nitrogen metabolism
Gene Summary 'Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. This gene product is a type I membrane protein that is highly expressed in normal tissues, such as kidney, colon and pancreas, and has been found to be overexpressed in 10% of clear cell renal carcinomas. Three transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2014]'
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.