MS4A7 (NM_206939) Human Untagged Clone

CAT#: SC308334

MS4A7 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MS4A7
• Synonyms: 4SPAN2; CD20L4; CFFM4; MS4A8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_206939, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTATTACAATCCCAAACCATGGGGGTTTCTCACAGCTTTACACCAAAGGGCATCACTATCCCTCAAA
  GAGAGAAACCTGGACACATGTACCAAAACGAAGATTACCTGCAGAACGGGCTGCCAACAGAAACCACCGT
  TCTTGGGACTGTCCAGATCCTGTGTTGCCTGTTGATTTCAAGTCTGGGGGCCATCTTGGTTTTTGCTCCC
  TACCCCTCCCACTTCAATCCAGCAATTTCCACCACTTTGATGTCTGGGTACCCATTTTTAGGAGCTCTGT
  GTTTTGGCATTACTGGATCCCTCTCAATTATCTCTGGAAAACAATCAACTAAGCCCTTTGACCTGAGCAG
  CTTGACCTCAAATGCAGTGAGTTCTGTTACTGCAGGAGCAGGCCTCTTCCTCCTTGCTGACAGCATGGTA
  GCCCTGAGGACTGCCTCTCAACATTGTGGCTCAGAAATGGATTATCTATCCTCATTGCCTTATTCGGAGT
  ACTATTATCCAATATATGAAATCAAAGATTGTCTCCTGACCAGTGTCAGTTTAACAGGTGTCCTAGTGGT
  GATGCTCATCTTCACTGTGCTGGAGCTCTTATTAGCTGCATACAGTTCTGTCTTTTGGTGGAAACAGCTC
  TACTCCAACAACCCTGGGAGTTCATTTTCCTCGACCCAGTCACAAGATCATATCCAACAGGTCAAAAAGA
  GTTCTTCACGGTCTTGGATATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_206939
• ORF Size: 723 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_206939.1, NP_996822.1
• RefSeq Size: 2976
• RefSeq ORF: 723
• Locus ID: 58475
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) uses an alternative splice site for the first exon compared to variant 1. Both variants 3 and 1 encode the same isoform (1).