Bim (BCL2L11) (NM_207002) Human Untagged Clone
CAT#: SC308358
BCL2L11 (untagged)-Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 9
"NM_207002" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BCL2L11 |
Synonyms | BAM; BIM; BOD |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_207002 edited
ATGGCAAAGCAACCTTCTGATGTAAGTTCTGAGTGTGACCGAGAAGGTAGACAATTGCAG CCTGCGGAGAGGCCTCCCCAGCTCAGACCTGGGGCCCCTACCTCCCTACAGACAGAGCCA CAAGACAGGAGCCCAGCACCCATGAGTTGTGACAAATCAACACAAACCCCAAGTCCTCCT TGCCAGGCCTTCAACCACTATCTCAGTGCAATGGTAGTCATCCTAGAGGATATAGGTGAT CTTTCACTGTGCTTTGGATTTATATTTACTGGCTTAGATTTGTATGGCCACCACCATAGT CAAGATACAGAACAACTCAACCACAAGGATTTCTCATGA |
Restriction Sites | Please inquire |
ACCN | NM_207002 |
ORF Size | 339 bp |
Insert Size | 300 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_207002.1, NP_996885.1 |
RefSeq Size | 453 |
RefSeq ORF | 339 |
Locus ID | 10018 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (9, also known as Bim-gamma) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. The resulting isoform (9) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224938 | BCL2L11 (Myc-DDK-tagged)-Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 9 |
USD 420.00 |
|
RG224938 | BCL2L11 (GFP-tagged) - Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 9 |
USD 460.00 |
|
RC224938L3 | Lenti ORF clone of Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 9, Myc-DDK-tagged |
USD 620.00 |
|
RC224938L4 | Lenti ORF clone of Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 9, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review