CCL4L1 (NM_207007) Human Untagged Clone

CAT#: SC308362

CCL4L2 (untagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2)


  "NM_207007" in other vectors (5)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCL4L1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCL4L1
Synonyms AT744.2; CCL4L; LAG-1; LAG1; MIP-1-beta; SCYA4L; SCYA4L1; SCYA4L2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_207007, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTCTGCGTGACTGTCCTGTCTCTCCTCGTGCTAGTAGCTGCCTTCTGCTCTCTA
GCACTCTCAGCACCAATGGGCTCAGACCCTCCCACCGCCTGCTGCTTTTCTTACACCGCG
AGGAAGCTTCCTCGCAACTTTGTGGTAGATTACTATGAGACCAGCAGCCTCTGCTCCCAG
CCAGCTGTGGTATTCCAAACCAAAAGAGGCAAGCAAGTCTGCGCTGACCCCAGTGAGTCC
TGGGTCCAGGAGTACGTGTATGACCTGGAACTGAACTGA
Restriction Sites Please inquire     
ACCN NM_207007
ORF Size 279 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_207007.2, NP_996890.1
RefSeq Size 685
RefSeq ORF 279
Locus ID 388372
Protein Families Druggable Genome, Transmembrane
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway
Gene Summary This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this family member is similar to the chemokine (C-C motif) ligand 4 product, which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals, where most individuals have one to five copies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (CCL4L) represents the longer transcript and encodes the supported protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.