CCL4L1 (NM_207007) Human Untagged Clone
CAT#: SC308362
CCL4L2 (untagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2)
"NM_207007" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CCL4L1 |
Synonyms | AT744.2; CCL4L; LAG-1; LAG1; MIP-1-beta; SCYA4L; SCYA4L1; SCYA4L2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_207007, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTCTGCGTGACTGTCCTGTCTCTCCTCGTGCTAGTAGCTGCCTTCTGCTCTCTA GCACTCTCAGCACCAATGGGCTCAGACCCTCCCACCGCCTGCTGCTTTTCTTACACCGCG AGGAAGCTTCCTCGCAACTTTGTGGTAGATTACTATGAGACCAGCAGCCTCTGCTCCCAG CCAGCTGTGGTATTCCAAACCAAAAGAGGCAAGCAAGTCTGCGCTGACCCCAGTGAGTCC TGGGTCCAGGAGTACGTGTATGACCTGGAACTGAACTGA |
Restriction Sites | Please inquire |
ACCN | NM_207007 |
ORF Size | 279 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_207007.2, NP_996890.1 |
RefSeq Size | 685 |
RefSeq ORF | 279 |
Locus ID | 388372 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway |
Gene Summary | This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this family member is similar to the chemokine (C-C motif) ligand 4 product, which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals, where most individuals have one to five copies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (CCL4L) represents the longer transcript and encodes the supported protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC321047 | CCL4L2 (untagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
USD 420.00 |
|
RC210008 | CCL4L2 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
USD 98.00 |
|
RG210008 | CCL4L2 (GFP-tagged) - Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
USD 460.00 |
|
RC210008L3 | Lenti-ORF clone of CCL4L2 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
USD 620.00 |
|
RC210008L4 | Lenti-ORF clone of CCL4L2 (mGFP-tagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review