AP3M1 (NM_207012) Human Untagged Clone

CAT#: SC308364

AP3M1 (untagged)-Human adaptor-related protein complex 3, mu 1 subunit (AP3M1), transcript variant 1


  "NM_207012" in other vectors (4)

Reconstitution Protocol

USD 710.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AP3M1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AP3M1
Synonyms RP11-178G16.4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_207012, the custom clone sequence may differ by one or more nucleotides


ATGATCCACAGTCTATTTCTCATAAACTGTTCCGGTGACATATTTCTAGAGAAGCACTGGAAGAGCGTTG
TGAGCCAGTCTGTCTGTGATTATTTCTTTGAAGCTCAAGAGAAAGCTGCTGATGTTGAAAATGTACCACC
TGTCATTTCAACACCTCACCACTACCTCATCAGTATCTACCGGGATAAGCTCTTCTTTGTATCTGTCATA
CAGACCGAAGTGCCACCTCTCTTTGTAATTGAGTTCCTACATCGAGTTGCTGACACTTTTCAGGACTACT
TTGGTGAGTGTTCAGAGGCTGCAATTAAGGATAATGTGGTCATAGTATATGAACTCTTAGAAGAAATGTT
AGACAATGGATTTCCACTGGCTACCGAATCTAACATTTTGAAAGAATTGATTAAACCACCAACAATTCTA
CGCTCTGTTGTCAACTCTATTACAGGCAGTAGTAATGTTGGGGACACACTCCCCACCGGGCAGCTGTCCA
ACATACCATGGCGTCGGGCAGGGGTAAAGTACACAAACAATGAAGCCTATTTTGATGTTGTTGAAGAAAT
AGACGCAATTATAGATAAATCAGGATCTACAGTCTTTGCAGAAATTCAGGGGGTCATTGATGCTTGCATT
AAACTATCTGGAATGCCTGATCTCTCCCTTTCTTTCATGAACCCTAGGCTTCTGGATGATGTCAGCTTTC
ACCCCTGCATCCGGTTCAAGCGTTGGGAATCTGAAAGAGTTTTGTCATTTATTCCTCCAGATGGAAATTT
CCGACTCATATCATACCGTGTCAGCTCACAAAATCTAGTGGCAATACCAGTGTATGTGAAACATAGTATC
AGCTTTAAGGAGAACAGTTCTTGCGGCAGATTTGATATAACAATTGGACCAAAGCAGAATATGGGGAAAA
CTATTGAAGGAATTACAGTGACAGTTCACATGCCAAAAGTTGTGCTGAACATGAACCTGACACCCACACA
AGGCAGCTATACATTTGATCCAGTCACCAAGGTACTAACATGGGATGTGGGAAAAATTACTCCACAAAAG
CTCCCAAGTCTTAAAGGACTGGTAAATTTACAGTCTGGAGCCCCCAAACCAGAAGAGAATCCGAGCCTCA
ACATACAGTTTAAGATCCAGCAGCTTGCTATTTCAGGCTTAAAAGTAAACCGTTTGGACATGTATGGGGA
GAAATATAAGCCATTTAAAGGAGTCAAATACGTCACGAAAGCTGGAAAGTTCCAAGTGAGGACATGA


Restriction Sites SgfI-MluI     
ACCN NM_207012
ORF Size 1257 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_207012.3, NP_996895.1
RefSeq Size 5287
RefSeq ORF 1257
Locus ID 26985
Protein Pathways Lysosome
Gene Summary The protein encoded by this gene is the medium subunit of AP-3, which is an adaptor-related protein complex associated with the Golgi region as well as more peripheral intracellular structures. AP-3 facilitates the budding of vesicles from the Golgi membrane, and it may directly function in protein sorting to the endosomal/lysosomal system. AP-3 is a heterotetrameric protein complex composed of two large subunits (delta and beta3), a medium subunit (mu3), and a small subunit (sigma 3). Mutations in one of the large subunits of AP-3 have been associated with the Hermansky-Pudlak syndrome, a genetic disorder characterized by defective lysosome-related organelles. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1, 2, 3 and 4 all encode isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.