AP3M1 (NM_207012) Human Untagged Clone
CAT#: SC308364
AP3M1 (untagged)-Human adaptor-related protein complex 3, mu 1 subunit (AP3M1), transcript variant 1
"NM_207012" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AP3M1 |
Synonyms | RP11-178G16.4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_207012, the custom clone sequence may differ by one or more nucleotides
ATGATCCACAGTCTATTTCTCATAAACTGTTCCGGTGACATATTTCTAGAGAAGCACTGGAAGAGCGTTG TGAGCCAGTCTGTCTGTGATTATTTCTTTGAAGCTCAAGAGAAAGCTGCTGATGTTGAAAATGTACCACC TGTCATTTCAACACCTCACCACTACCTCATCAGTATCTACCGGGATAAGCTCTTCTTTGTATCTGTCATA CAGACCGAAGTGCCACCTCTCTTTGTAATTGAGTTCCTACATCGAGTTGCTGACACTTTTCAGGACTACT TTGGTGAGTGTTCAGAGGCTGCAATTAAGGATAATGTGGTCATAGTATATGAACTCTTAGAAGAAATGTT AGACAATGGATTTCCACTGGCTACCGAATCTAACATTTTGAAAGAATTGATTAAACCACCAACAATTCTA CGCTCTGTTGTCAACTCTATTACAGGCAGTAGTAATGTTGGGGACACACTCCCCACCGGGCAGCTGTCCA ACATACCATGGCGTCGGGCAGGGGTAAAGTACACAAACAATGAAGCCTATTTTGATGTTGTTGAAGAAAT AGACGCAATTATAGATAAATCAGGATCTACAGTCTTTGCAGAAATTCAGGGGGTCATTGATGCTTGCATT AAACTATCTGGAATGCCTGATCTCTCCCTTTCTTTCATGAACCCTAGGCTTCTGGATGATGTCAGCTTTC ACCCCTGCATCCGGTTCAAGCGTTGGGAATCTGAAAGAGTTTTGTCATTTATTCCTCCAGATGGAAATTT CCGACTCATATCATACCGTGTCAGCTCACAAAATCTAGTGGCAATACCAGTGTATGTGAAACATAGTATC AGCTTTAAGGAGAACAGTTCTTGCGGCAGATTTGATATAACAATTGGACCAAAGCAGAATATGGGGAAAA CTATTGAAGGAATTACAGTGACAGTTCACATGCCAAAAGTTGTGCTGAACATGAACCTGACACCCACACA AGGCAGCTATACATTTGATCCAGTCACCAAGGTACTAACATGGGATGTGGGAAAAATTACTCCACAAAAG CTCCCAAGTCTTAAAGGACTGGTAAATTTACAGTCTGGAGCCCCCAAACCAGAAGAGAATCCGAGCCTCA ACATACAGTTTAAGATCCAGCAGCTTGCTATTTCAGGCTTAAAAGTAAACCGTTTGGACATGTATGGGGA GAAATATAAGCCATTTAAAGGAGTCAAATACGTCACGAAAGCTGGAAAGTTCCAAGTGAGGACATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_207012 |
ORF Size | 1257 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_207012.3, NP_996895.1 |
RefSeq Size | 5287 |
RefSeq ORF | 1257 |
Locus ID | 26985 |
Protein Pathways | Lysosome |
Gene Summary | The protein encoded by this gene is the medium subunit of AP-3, which is an adaptor-related protein complex associated with the Golgi region as well as more peripheral intracellular structures. AP-3 facilitates the budding of vesicles from the Golgi membrane, and it may directly function in protein sorting to the endosomal/lysosomal system. AP-3 is a heterotetrameric protein complex composed of two large subunits (delta and beta3), a medium subunit (mu3), and a small subunit (sigma 3). Mutations in one of the large subunits of AP-3 have been associated with the Hermansky-Pudlak syndrome, a genetic disorder characterized by defective lysosome-related organelles. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1, 2, 3 and 4 all encode isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214850 | AP3M1 (Myc-DDK-tagged)-Human adaptor-related protein complex 3, mu 1 subunit (AP3M1), transcript variant 1 |
USD 420.00 |
|
RG214850 | AP3M1 (GFP-tagged) - Human adaptor-related protein complex 3, mu 1 subunit (AP3M1), transcript variant 1 |
USD 460.00 |
|
RC214850L3 | Lenti ORF clone of Human adaptor-related protein complex 3, mu 1 subunit (AP3M1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC214850L4 | Lenti ORF clone of Human adaptor-related protein complex 3, mu 1 subunit (AP3M1), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review