ELOB (NM_207013) Human Untagged Clone

CAT#: SC308365

TCEB2 (untagged)-Human transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) (TCEB2), transcript variant 2


  "NM_207013" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ELOB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ELOB
Synonyms SIII; TCEB2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_207013 edited
ATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCATCTTCACGGACGCCAAGGAG
TCCAGCACGGTGTTCGAACTGAAGCGCATCGTCGAGGGCATCCTCAAGCGGCCTCCTGAC
GAGCAGCGGCTGTACAAGGATGACCAACTCTTGGATGATGGCAAGACACTGGGCGAGTGT
GGCTTCACCAGTCAAACAGCACGGCCACAGGCCCCAGCCACAGTGGGGCTGGCCTTCCGG
GCAGATGACACCTTTGAGGCCCTGTGCATCGAGCCGTTTTCCAGCCCGCCAGAGCTGCCC
GATGTGATGAAGCCCCAGGACTCGGGAAGCAGTGCCAATGAACAAGCCGTGCACCTGCAT
GTCCACTCCCAGACGATGGCCAAGAACAGAAACACAAGCTGGAGCCAGTGTCCTGGTTTG
ACAGCATGTTCAACGAGGGAACCCCAAGACGGACCCACACAGGTCCACCCACGCTGGGGG
CTGTAA
>OriGene 5' read for NM_207013 unedited
TTTTTTTTTCGTTTCGTTATCCAAAACCCCCCCCGTTAGCATTTGTAATACGATTACTAT
AGGCGGCCGCGCAATTCGCACGAGGTCGAGGGGTATAGCAGCAGCCGCGATGGACGTGTT
CCTCATGATCCGGCGCCACAAGACCACCATCTTCACGGACGCCAAGGAGTCCAGCACGGT
GTTCGAACTGAAGCGCATCGTCGAGGGCATCCTCAAGCGGCCTCCTGACGAGCAGCGGCT
GTACAAGGATGACCAACTCTTGGATGATGGCAAGACACTGGGCGAGTGTGGCTTCACCAG
TCAAACAGCACGGCCACAGGCCCCAGCCACAGTGGGGCTGGCCTTCCGGGCAGATGACAC
CTTTGAGGCCCTGTGCATCGAGCCGTTTTCCAGCCCGCCAGAGCTGCCCGATGTGATGAA
GCCCCAGGACTCGGGAAGCAGTGCCAATGAACAAGCCGTGCACCTGCATGTCCACTCCCA
GACGATGGCCAAGAACAGAAACACAAGCTGGAGCCAGTGTCCTGGTTTGACAGCATGTTC
AACGAGGGAACCCCAAGACGGACCCACACAGGTCCACCCACGCTGGGGGCTGTAATCACG
GAGGGAAGTGGCTGCCCCCTTACCACCACCTTTAATAAACAGTCTACAGACCCAAAAAAA
AAAAAAAAAAAAAAACTCGACTCTAGATTGCGGCCGCGGGCATAGCTGTTTCCTGAACAG
AACCCGGGGTGGCATCCCTGTGACCCCTCCCCATGCCTTTCCTGGCCCTGGAAGTTGCCA
CTCCAATGCCCACCAGCCTTGTCCTAATAAAATAAGTTGCATCATTTTGTCTGACTAAGG
GTCCTTCTATATATTATGGGGTGAGGGGGGGGCGGTTCTTGAACCAAGCCCCAATTTTGG
TCTAAACCTCTTGTCGGCTCTCGTCGCGGTCTTTGGTTACCCCCATTGCA
Restriction Sites NotI-NotI     
ACCN NM_207013
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. These result in the substitution of 1 aa and insertion of 1 aa.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_207013.1, NP_996896.1
RefSeq Size 609 bp
RefSeq ORF 486 bp
Locus ID 6923
Cytogenetics 16p13.3
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Pathways in cancer, Renal cell carcinoma, Ubiquitin mediated proteolysis
Gene Summary 'This gene encodes the protein elongin B, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. Pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, Aug 2008]'
Transcript Variant: This variant (2) lacks a segment in the 3' region, resulting in a downstream stop codon, compared to variant 1. The resulting isoform (b) has a longer C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.