ENSA (NM_207047) Human Untagged Clone
CAT#: SC308380
ENSA (untagged)-Human endosulfine alpha (ENSA), transcript variant 7
"NM_207047" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ENSA |
Synonyms | ARPP-19e |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_207047, the custom clone sequence may differ by one or more nucleotides
ATGGCTGGTGGTCTTGGGTGTGATGTGTGTTATTGGTTTGTAGAGGACACGCAGGAGAAA GAAGGTATTCTGCCTGAGAGAGCTGAAGAGGCAAAGCTAAAGGCCAAATACCCAAGCCTA GGACAAAAGCCTGGAGGCTCCGACTTCCTCATGAAGAGACTCCAGAAAGGGCAAAAGTAC TTTGACTCAGGAGACTACAACATGGCCAAAGCCAAGATGAAGAATAAGCAGCTGCCAAGT GCAGGACCAGACAAGAACCTGGTGACTGGTGATCACATCCCCACCCCACAGGATCTGCCC CAGAGAAAGTCCTCGCTCGTCACCAGCAAGCTTGCGGGGTAA |
Restriction Sites | Please inquire |
ACCN | NM_207047 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_207047.1, NP_996930.1 |
RefSeq Size | 2747 bp |
RefSeq ORF | 342 bp |
Locus ID | 2029 |
Cytogenetics | 1q21.3 |
Protein Families | Druggable Genome |
Gene Summary | 'The protein encoded by this gene belongs to a highly conserved cAMP-regulated phosphoprotein (ARPP) family. This protein was identified as an endogenous ligand for the sulfonylurea receptor, ABCC8/SUR1. ABCC8 is the regulatory subunit of the ATP-sensitive potassium (KATP) channel, which is located on the plasma membrane of pancreatic beta cells and plays a key role in the control of insulin release from pancreatic beta cells. This protein is thought to be an endogenous regulator of KATP channels. In vitro studies have demonstrated that this protein modulates insulin secretion through the interaction with KATP channel, and this gene has been proposed as a candidate gene for type 2 diabetes. At least eight alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (7) has multiple differences compared to variant 1. The resulting isoform (7) has a distinct and shorter N-terminus and a shorter C-terminus, and lacks an internal region, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219133 | ENSA (Myc-DDK-tagged)-Human endosulfine alpha (ENSA), transcript variant 7 |
USD 420.00 |
|
RG219133 | ENSA (GFP-tagged) - Human endosulfine alpha (ENSA), transcript variant 7 |
USD 460.00 |
|
RC219133L3 | Lenti-ORF clone of ENSA (Myc-DDK-tagged)-Human endosulfine alpha (ENSA), transcript variant 7 |
USD 620.00 |
|
RC219133L4 | Lenti-ORF clone of ENSA (mGFP-tagged)-Human endosulfine alpha (ENSA), transcript variant 7 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review