Keratinocyte differentiation associated protein (KRTDAP) (NM_207392) Human Untagged Clone

CAT#: SC308507

KRTDAP (untagged)-Human keratinocyte differentiation-associated protein (KRTDAP)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KRTDAP
• Synonyms: KDAP; UNQ467
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_207392, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGATCCCGGTCCTTCCTGCCGTGGTGCTCCTCTCCCTCCTGGTGCTCCACTCTGCCCAGGGAGCCA
  CCCTGGGTGGTCCTGAGGAAGAAAGCACCATTGAGAATTATGCGTCACGACCCGAGGCCTTTAACACCCC
  GTTCCTGAACATCGACAAATTGCGATCTGCGTTTAAGGCTGATGAGTTCCTGAACTGGCACGCCCTCTTT
  GAGTCTATCAAAAGGAAACTTCCTTTCCTCAACTGGGATGCCTTTCCTAAGCTGAAAGGACTGAGGAGCG
  CAACTCCTGATGCCCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_207392
• ORF Size: 300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_207392.2, NP_997275.1
• RefSeq Size: 500
• RefSeq ORF: 300
• Locus ID: 388533
• Gene Summary: This gene encodes a protein which may function in the regulation of keratinocyte differentiation and maintenance of stratified epithelia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).