ZAP70 (NM_207519) Human Untagged Clone

CAT#: SC308606

ZAP70 (untagged)-Human zeta-chain (TCR) associated protein kinase 70kDa (ZAP70), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZAP70
• Synonyms: ADMIO2; IMD48; SRK; STCD; STD; TZK; ZAP-70
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_207519, the custom clone sequence may differ by one or more nucleotides
  ATGCCCATGGACACGAGCGTGTATGAGAGCCCCTACAGCGACCCAGAGGAGCTCAAGGAC
  AAGAAGCTCTTCCTGAAGCGCGATAACCTCCTCATAGCTGACATTGAACTTGGCTGCGGC
  AACTTTGGCTCAGTGCGCCAGGGCGTGTACCGCATGCGCAAGAAGCAGATCGACGTGGCC
  ATCAAGGTGCTGAAGCAGGGCACGGAGAAGGCAGACACGGAAGAGATGATGCGCGAGGCG
  CAGATCATGCACCAGCTGGACAACCCCTACATCGTGCGGCTCATTGGCGTCTGCCAGGCC
  GAGGCCCTCATGCTGGTCATGGAGATGGCTGGGGGCGGGCCGCTGCACAAGTTCCTGGTC
  GGCAAGAGGGAGGAGATCCCTGTGAGCAATGTGGCCGAGCTGCTGCACCAGGTGTCCATG
  GGGATGAAGTACCTGGAGGAGAAGAACTTTGTGCACCGTGACCTGGCGGCCCGCAACGTC
  CTGCTGGTTAACCGGCACTACGCCAAGATCAGCGACTTTGGCCTCTCCAAAGCACTGGGT
  GCCGACGACAGCTACTACACTGCCCGCTCAGCAGGGAAGTGGCCGCTCAAGTGGTACGCA
  CCCGAATGCATCAACTTCCGCAAGTTCTCCAGCCGCAGCGATGTCTGGAGCTATGGGGTC
  ACCATGTGGGAGGCCTTGTCCTACGGCCAGAAGCCCTACAAGAAGATGAAAGGGCCGGAG
  GTCATGGCCTTCATCGAGCAGGGCAAGCGGATGGAGTGCCCACCAGAGTGTCCACCCGAA
  CTGTACGCACTCATGAGTGACTGCTGGATCTACAAGTGGGAGGATCGCCCCGACTTCCTG
  ACCGTGGAGCAGCGCATGCGAGCCTGTTACTACAGCCTGGCCAGCAAGGTGGAAGGGCCC
  CCAGGCAGCACACAGAAGGCTGAGGCTGCCTGTGCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_207519
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_207519.1, NP_997402.1
• RefSeq Size: 1468 bp
• RefSeq ORF: 939 bp
• Locus ID: 7535
• Cytogenetics: 2q11.2
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: Natural killer cell mediated cytotoxicity, Primary immunodeficiency, T cell receptor signaling pathway
• Gene Summary: 'This gene encodes an enzyme belonging to the protein tyrosine kinase family, and it plays a role in T-cell development and lymphocyte activation. This enzyme, which is phosphorylated on tyrosine residues upon T-cell antigen receptor (TCR) stimulation, functions in the initial step of TCR-mediated signal transduction in combination with the Src family kinases, Lck and Fyn. This enzyme is also essential for thymocyte development. Mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T-cells. Two transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2, also known as TZK) differs in the 5' UTR and lacks several exons in the 5' coding region, compared to variant 1. The resulting isoform (2, also known as truncated ZAP kinase) is shorter at the N-terminus, compared to isoform 1. CCDS Note: This CCDS representation is based on AB083211.1 and is supported by data in PMID:14985102. This publication also shows the existence of this variant in mouse, as well as the presence of this truncated isoform in various mouse tissues in vivo.