ARL4 (ARL4A) (NM_212460) Human Untagged Clone

CAT#: SC308626

ARL4A (untagged)-Human ADP-ribosylation factor-like 4A (ARL4A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARL4A
• Synonyms: ARL4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_212460, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGAATGGGCTGTCAGACCAGACTTCTATCCTGTCCAACCTGCCTTCATTTCAGTCTTTCCACATTG
  TTATTCTGGGTTTGGACTGTGCTGGAAAGACAACTGTCTTATACAGGCTGCAGTTCAATGAATTTGTAAA
  TACCGTACCTACCAAAGGATTTAACACTGAGAAAATTAAGGTAACCTTGGGAAATTCTAAAACAGTCACT
  TTTCACTTCTGGGATGTAGGTGGTCAGGAGAAATTAAGGCCACTGTGGAAGTCATATACCAGATGCACAG
  ATGGCATTGTATTTGTTGTGGACTCTGTTGATGTCGAAAGGATGGAAGAAGCCAAAACTGAACTTCACAA
  AATAACTAGGATATCAGAAAATCAGGGAGTCCCTGTACTTATAGTTGCTAACAAACAAGATTTGAGGAAC
  TCATTGTCACTTTCAGAAATTGAGAAATTGTTAGCAATGGGTGAACTGAGCTCATCAACTCCTTGGCATT
  TGCAGCCTACCTGTGCAATCATAGGAGATGGCCTAAAGGAAGGACTTGAGAAACTACATGATATGATCAT
  TAAAAGAAGAAAAATGTTGCGGCAACAGAAAAAGAAAAGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_212460
• ORF Size: 603 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_212460.3, NP_997625.1
• RefSeq Size: 2983
• RefSeq ORF: 603
• Locus ID: 10124
• Protein Families: Stem cell - Pluripotency
• Gene Summary: ADP-ribosylation factor-like 4A is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL4A is similar to ARL4C and ARL4D and each has a nuclear localization signal and an unusually high guaninine nucleotide exchange rate. ARL4A is located in both the nuclear and extranuclear cell compartments. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.