B4GALT4 (NM_212543) Human Untagged Clone
CAT#: SC308647
B4GALT4 (untagged)-Human UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 (B4GALT4), transcript variant 1
"NM_212543" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | B4GALT4 |
Synonyms | B4Gal-T4; beta4Gal-T4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_212543, the custom clone sequence may differ by one or more nucleotides
ATGGGCTTCAACCTGACTTTCCACCTTTCCTACAAATTCCGATTACTGTTGCTGTTGACTTTGTGCCTGA CAGTGGTTGGGTGGGCCACCAGTAACTACTTCGTGGGTGCCATTCAAGAGATTCCTAAAGCAAAGGAGTT CATGGCTAATTTCCATAAGACCCTCATTTTGGGGAAGGGAAAAACTCTGACTAATGAAGCATCCACGAAG AAGGTAGAACTTGACAACTGCCCTTCTGTGTCTCCTTACCTCAGAGGCCAGAGCAAGCTCATTTTCAAAC CAGATCTCACTTTGGAAGAGGTACAGGCAGAAAATCCCAAAGTGTCCAGAGGCCGGTATCGCCCTCAGGA ATGTAAAGCTTTACAGAGGGTCGCCATCCTCGTTCCCCACCGGAACAGAGAGAAACACCTGATGTACCTG CTGGAACATCTGCATCCCTTCCTGCAGAGGCAGCAGCTGGATTATGGCATCTACGTCATCCACCAGGCTG AAGGTAAAAAGTTTAATCGAGCCAAACTCTTGAATGTGGGCTATCTAGAAGCCCTCAAGGAAGAAAATTG GGACTGCTTTATATTCCACGATGTGGACCTGGTACCCGAGAATGACTTTAACCTTTACAAGTGTGAGGAG CATCCCAAGCATCTGGTGGTTGGCAGGAACAGCACTGGGTACAGGTTACGTTACAGTGGATATTTTGGGG GTGTTACTGCCCTAAGCAGAGAGCAGTTTTTCAAGGTGAATGGATTCTCTAACAACTACTGGGGATGGGG AGGCGAAGACGATGACCTCAGACTCAGGGTTGAGCTCCAAAGAATGAAAATTTCCCGGCCCCTGCCTGAA GTGGGTAAATATACAATGGTCTTCCACACTAGAGACAAAGGCAATGAGGTGAACGCAGAACGGATGAAGC TCTTACACCAAGTGTCACGAGTCTGGAGAACAGATGGGTTGAGTAGTTGTTCTTATAAATTAGTATCTGT GGAACACAATCCTTTATATATCAACATCACAGTGGATTTCTGGTTTGGTGCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_212543 |
ORF Size | 1035 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_212543.1, NP_997708.1 |
RefSeq Size | 2366 |
RefSeq ORF | 1035 |
Locus ID | 8702 |
Protein Families | Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways |
Gene Summary | This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221047 | B4GALT4 (Myc-DDK-tagged)-Human UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 (B4GALT4), transcript variant 1 |
USD 420.00 |
|
RG221047 | B4GALT4 (GFP-tagged) - Human UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 (B4GALT4), transcript variant 1 |
USD 460.00 |
|
RC221047L3 | Lenti ORF clone of Human UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 (B4GALT4), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC221047L4 | Lenti ORF clone of Human UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 (B4GALT4), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review