B4GALT4 (NM_212543) Human Untagged Clone

CAT#: SC308647

B4GALT4 (untagged)-Human UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 (B4GALT4), transcript variant 1


  "NM_212543" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "B4GALT4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol B4GALT4
Synonyms B4Gal-T4; beta4Gal-T4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_212543, the custom clone sequence may differ by one or more nucleotides


ATGGGCTTCAACCTGACTTTCCACCTTTCCTACAAATTCCGATTACTGTTGCTGTTGACTTTGTGCCTGA
CAGTGGTTGGGTGGGCCACCAGTAACTACTTCGTGGGTGCCATTCAAGAGATTCCTAAAGCAAAGGAGTT
CATGGCTAATTTCCATAAGACCCTCATTTTGGGGAAGGGAAAAACTCTGACTAATGAAGCATCCACGAAG
AAGGTAGAACTTGACAACTGCCCTTCTGTGTCTCCTTACCTCAGAGGCCAGAGCAAGCTCATTTTCAAAC
CAGATCTCACTTTGGAAGAGGTACAGGCAGAAAATCCCAAAGTGTCCAGAGGCCGGTATCGCCCTCAGGA
ATGTAAAGCTTTACAGAGGGTCGCCATCCTCGTTCCCCACCGGAACAGAGAGAAACACCTGATGTACCTG
CTGGAACATCTGCATCCCTTCCTGCAGAGGCAGCAGCTGGATTATGGCATCTACGTCATCCACCAGGCTG
AAGGTAAAAAGTTTAATCGAGCCAAACTCTTGAATGTGGGCTATCTAGAAGCCCTCAAGGAAGAAAATTG
GGACTGCTTTATATTCCACGATGTGGACCTGGTACCCGAGAATGACTTTAACCTTTACAAGTGTGAGGAG
CATCCCAAGCATCTGGTGGTTGGCAGGAACAGCACTGGGTACAGGTTACGTTACAGTGGATATTTTGGGG
GTGTTACTGCCCTAAGCAGAGAGCAGTTTTTCAAGGTGAATGGATTCTCTAACAACTACTGGGGATGGGG
AGGCGAAGACGATGACCTCAGACTCAGGGTTGAGCTCCAAAGAATGAAAATTTCCCGGCCCCTGCCTGAA
GTGGGTAAATATACAATGGTCTTCCACACTAGAGACAAAGGCAATGAGGTGAACGCAGAACGGATGAAGC
TCTTACACCAAGTGTCACGAGTCTGGAGAACAGATGGGTTGAGTAGTTGTTCTTATAAATTAGTATCTGT
GGAACACAATCCTTTATATATCAACATCACAGTGGATTTCTGGTTTGGTGCATGA


Restriction Sites SgfI-MluI     
ACCN NM_212543
ORF Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_212543.1, NP_997708.1
RefSeq Size 2366
RefSeq ORF 1035
Locus ID 8702
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways
Gene Summary This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.