Nebulette (NEBL) (NM_213569) Human Untagged Clone

CAT#: SC308659

NEBL (untagged)-Human nebulette (NEBL), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NEBL
• Synonyms: LASP2; LNEBL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_213569, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACCCCCAGTGCGCCCGTTGCGGAAAAGTCGTGTATCCCACCGAGAAAGTCAACTGCCTGGATAAGT
  ATTGGCATAAAGGATGTTTCCATTGTGAGGTCTGCAAGATGGCACTCAACATGAACAACTACAAAGGCTA
  TGAAAAGAAGCCCTATTGTAATGCACACTACCCGAAGCAGTCCTTCACCACGGTGGCAGATACACCTGAA
  AATCTTCGCCTGAAGCAGCAAAGTGAATTGCAGAGTCAGGTCAAGTACAAAAGAGATTTTGAAGAAAGCA
  AAGGGAGGGGCTTCAGCATCGTCACGGACACTCCTGAGCTACAGAGACTGAAGAGGACTCAGGAGCAAAT
  CAGTAATGTAAAATACCATGAAGATTTTGAAAAAACAAAGGGGAGAGGCTTTACTCCCGTCGTGGACGAT
  CCTGTGACAGAGAGAGTGAGGAAGAACACCCAGGTGGTCAGCGATGCTGCCTATAAAGGGGTCCACCCTC
  ACATCGTGGAGATGGACAGGAGACCTGGAATCATTGTTGCACCTGTTCTTCCCGGAGCCTATCAGCAAAG
  CCATTCCCAAGGCTATGGCTACATGCACCAGACCAGTGTGTCATCCATGAGATCAATGCAGCATTCACCA
  AATCTAAGGACCTACCGAGCCATGTACGATTACAGTGCCCAGGATGAAGACGAGGTCTCCTTTAGAGACG
  GCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACGGCACAGTGCAGAGAACAGGGAG
  AACAGGAATGCTCCCAGCGAATTACATTGAGTTTGTTAATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_213569
• ORF Size: 813 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_213569.2, NP_998734.1
• RefSeq Size: 6956
• RefSeq ORF: 813
• Locus ID: 10529
• Gene Summary: This gene encodes a nebulin like protein that is abundantly expressed in cardiac muscle. The encoded protein binds actin and interacts with thin filaments and Z-line associated proteins in striated muscle. This protein may be involved in cardiac myofibril assembly. A shorter isoform of this protein termed LIM nebulette is expressed in non-muscle cells and may function as a component of focal adhesion complexes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (2) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus compared to isoform 1. This isoform is referred to as LIM-nebulette or the non-muscle isoform.