CHCHD10 (NM_213720) Human Untagged Clone

CAT#: SC308703

CHCHD10 (untagged)-Human coiled-coil-helix-coiled-coil-helix domain containing 10 (CHCHD10)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHCHD10
• Synonyms: C22orf16; FTDALS2; IMMD; MIX17A; N27C7-4; SMAJ
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_213720, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTCGGGGAAGCCGCAGCGCGGCCTCCCGGCCAGCCAGCCGCCCAGCCGCGCCCTCTGCCCACCCGC
  CCGCGCACCCACCGCCCTCGGCAGCCGCCCCAGCCCCCGCCCCTTCGGGCCAGCCGGGGCTCATGGCTCA
  GATGGCGACCACGGCCGCAGGGGTAGCCGTGGGCTCGGCTGTGGGACACGTCATGGGCAGCGCCCTGACC
  GGAGCCTTCAGCGGGGGGAGCTCGGAGCCCTCCCAGCCTGCTGTCCAGCAGGCCCCCACCCCCGCTGCCC
  CCCAGCCCCTGCAGATGGGGCCCTGCGCCTACGAGATCAGGCAGTTCCTGGACTGTTCCACCACTCAGAG
  TGACCTGTCCCTGTGTGAGGGCTTCAGCGAGGCCCTGAAGCAGTGCAAGTACTACCATGGTCTGAGCTCC
  CTGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_213720
• ORF Size: 429 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_213720.2, NP_998885.1
• RefSeq Size: 718
• RefSeq ORF: 429
• Locus ID: 400916
• Gene Summary: This gene encodes a mitochondrial protein that is enriched at cristae junctions in the intermembrane space. It may play a role in cristae morphology maintenance or oxidative phosphorylation. Mutations in this gene cause frontotemporal dementia and/or amyotrophic lateral sclerosis-2. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 7 and 19. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.