RPLP1 (NM_213725) Human Untagged Clone

CAT#: SC308706

RPLP1 (untagged)-Human ribosomal protein, large, P1 (RPLP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPLP1
• Synonyms: LP1; P1; RPP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_213725, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCTCTGTCTCCGAGCTCGCCTGCATCTACTCGGCCCTCATTCTGCACGACGATGAGGTGACAGTCA
  CGGCCCTGGCCAACGTCAACATTGGGAGCCTCATCTGCAATGTAGGGGCCGGTGGACCTGCTCCAGCAGC
  TGGTGCTGCACCAGCAGGAGGTCCTGCCCCCTCCACTGCTGCTGCTCCAGCTGAGGAGAAGAAAGTGGAA
  GCAAAGAAAGAAGAATCCGAGGAGTCTGATGATGACATGGGCTTTGGTCTTTTTGACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_213725
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_213725.1, NP_998890.1
• RefSeq Size: 437 bp
• RefSeq ORF: 270 bp
• Locus ID: 6176
• Cytogenetics: 15q23
• Protein Pathways: Ribosome
• Gene Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P2. The P1 protein can interact with P0 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Two alternatively spliced transcript variants that encode different proteins have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) lacks an alternate in-frame segment, compared to variant 1, resulting in a shorter protein (isoform 2) when compared to isoform 1. CCDS Note: This CCDS ID represents a variant of the RPLP1 gene that is based on a splice pattern found in several ESTs, including BM768334.1, BM508180.1, EL948616.1 and AJ713466.1.