PXR (NR1I2) (NM_033013) Human Untagged Clone
CAT#: SC308735
NR1I2 (untagged)-Human nuclear receptor subfamily 1, group I, member 2 (NR1I2), transcript variant 3
"NM_033013" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NR1I2 |
Synonyms | BXR; ONR1; PAR; PAR1; PAR2; PARq; PRR; PXR; SAR; SXR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_033013, the custom clone sequence may differ by one or more nucleotides
CTGGAGGTGAGACCCAAAGAAAGCTGGAACCATGCTGACTTTGTACACTGTGAGGACACAGAGTCTGTTC CTGGAAAGCCCAGTGTCAACGCAGATGAGGAAGTCGGAGGTCCCCAAATCTGCCGTGTATGTGGGGACAA GGCCACTGGCTATCACTTCAATGTCATGACATGTGAAGGATGCAAGGGCTTTTTCAGGAGGGCCATGAAA CGCAACGCCCGGCTGAGGTGCCCCTTCCGGAAGGGCGCCTGCGAGATCACCCGGAAGACCCGGCGACAGT GCCAGGCCTGCCGCCTGCGCAAGTGCCTGGAGAGCGGCATGAAGAAGGAGATGATCATGTCCGACGAGGC CGTGGAGGAGAGGCGGGCCTTGATCAAGCGGAAGAAAAGTGAACGGACAGGGACTCAGCCACTGGGAGTG CAGGGGCTGACAGAGGAGCAGCGGATGATGATCAGGGAGCTGATGGACGCTCAGATGAAAACCTTTGACA CTACCTTCTCCCATTTCAAGAATTTCCGGGTCTCTCTGCAGCTGCGGGGGGAGGATGGCAGTGTCTGGAA CTACAAACCCCCAGCCGACAGTGGCGGGAAAGAGATCTTCTCCCTGCTGCCCCACATGGCTGACATGTCA ACCTACATGTTCAAAGGCATCATCAGCTTTGCCAAAGTCATCTCCTACTTCAGGGACTTGCCCATCGAGG ACCAGATCTCCCTGCTGAAGGGGGCCGCTTTCGAGCTGTGTCAACTGAGATTCAACACAGTGTTCAACGC GGAGACTGGAACCTGGGAGTGTGGCCGGCTGTCCTACTGCTTGGAAGACACTGCAGGTGGCTTCCAGCAA CTTCTACTGGAGCCCATGCTGAAATTCCACTACATGCTGAAGAAGCTGCAGCTGCATGAGGAGGAGTATG TGCTGATGCAGGCCATCTCCCTCTTCTCCCCAGACCGCCCAGGTGTGCTGCAGCACCGCGTGGTGGACCA GCTGCAGGAGCAATTCGCCATTACTCTGAAGTCCTACATTGAATGCAATCGGCCCCAGCCTGCTCATAGG TTCTTGTTCCTGAAGATCATGGCTATGCTCACCGAGCTCCGCAGCATCAATGCTCAGCACACCCAGCGGC TGCTGCGCATCCAGGACATACACCCCTTTGCTACGCCCCTCATGCAGGAGTTGTTCGGCATCACAGGTAG CTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_033013 |
ORF Size | 1194 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_033013.2, NP_148934.1 |
RefSeq Size | 4335 |
RefSeq ORF | 1194 |
Locus ID | 8856 |
Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
Gene Summary | This gene product belongs to the nuclear receptor superfamily, members of which are transcription factors characterized by a ligand-binding domain and a DNA-binding domain. The encoded protein is a transcriptional regulator of the cytochrome P450 gene CYP3A4, binding to the response element of the CYP3A4 promoter as a heterodimer with the 9-cis retinoic acid receptor RXR. It is activated by a range of compounds that induce CYP3A4, including dexamethasone and rifampicin. Several alternatively spliced transcripts encoding different isoforms, some of which use non-AUG (CUG) translation initiation codon, have been described for this gene. Additional transcript variants exist, however, they have not been fully characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) contains an alternate 5' terminal exon, and uses a different acceptor splice site at one of the internal coding exons, compared to transcript variant 2. It initiates translation from an in-frame, downstream non-AUG (CUG) codon, resulting in a shorter isoform (3) with a different N-terminus and missing an internal segment, compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215094 | NR1I2 (Myc-DDK-tagged)-Human nuclear receptor subfamily 1, group I, member 2 (NR1I2), transcript variant 3 |
USD 420.00 |
|
RG215094 | NR1I2 (GFP-tagged) - Human nuclear receptor subfamily 1, group I, member 2 (NR1I2), transcript variant 3 |
USD 460.00 |
|
RC215094L3 | Lenti ORF clone of Human nuclear receptor subfamily 1, group I, member 2 (NR1I2), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC215094L4 | Lenti ORF clone of Human nuclear receptor subfamily 1, group I, member 2 (NR1I2), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review