Gemin 1 (SMN2) (NM_022877) Human Untagged Clone

CAT#: SC308807

SMN2 (untagged)-Human survival of motor neuron 2, centromeric (SMN2), transcript variant c


  "NM_022877" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SMN2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SMN2
Synonyms BCD541; C-BCD541; GEMIN1; SMNC; TDRD16B
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_022877 edited
GGCCCCACGCTGCGCACCCGCGGGTTTGCTATGGCGATGAGCAGCGGCGGCAGTGGTGGC
GGCGTCCCGGAGCAGGAGGATTCCGTGCTGTTCCGGCGCGGCACAGGCCAGAGCGATGAT
TCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTT
AAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCT
AAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAA
CAGTGGAAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCA
GCTACCATTGCTTCAATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATAT
GGAAATAGAGAGGAGCAAAATCTGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAAT
AATATAGAACAGAATGCTCAAGAGAATGAAAATGAAAGCCAAGTTTCAACAGATGAAAGT
GAGAACTCCAGGTCTCCTGGAAATAAATCAGATAACATCAAGCCCAAATCTGCTCCATGG
AACTCTTTTCTCCCTCCACCACCCCCCATGCCAGGGCCAAGACTGGGACCAGGAAAGATA
ATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGGGAAGT
ATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATGGAAATGCTGGCA
TAG
Restriction Sites Please inquire     
ACCN NM_022877
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_022877.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022877.1, NP_075015.1
RefSeq Size 1473 bp
RefSeq ORF 753 bp
Locus ID 6607
Cytogenetics 5q13.2
Protein Families Druggable Genome
Gene Summary 'This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. While mutations in the telomeric copy are associated with spinal muscular atrophy, mutations in this gene, the centromeric copy, do not lead to disease. This gene may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The full length protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Four transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Sep 2008]'
Transcript Variant: This variant (c) lacks two alternate exons in the 3' CDS compared to variant d. The resulting protein (isoform c) is shorter and has a distinct C-terminus compared to isoform d.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.