Caspase 1 (CASP1) (NM_033292) Human Untagged Clone

CAT#: SC308821

CASP1 (untagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant alpha

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CASP1
• Synonyms: ICE; IL1BC; P45
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_033292 edited
  GAGAAAAGCCATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCGTTCCAT
  GGGTGAAGGTACAATAAATGGCTTACTGGATGAATTATTACAGACAAGGGTGCTGAACAA
  GGAAGAGATGGAGAAAGTAAAACGTGAAAATGCTACAGTTATGGATAAGACCCGAGCTTT
  GATTGACTCCGTTATTCCGAAAGGGGCACAGGCATGCCAAATTTGCATCACATACATTTG
  TGAAGAAGACAGTTACCTGGCAGGGACGCTGGGACTCTCAGCAGATCAAACATCTGGAAA
  TTACCTTAATATGCAAGACTCTCAAGGAGTACTTTCTTCCTTTCCAGCTCCTCAGGCAGT
  GCAGGACAACCCAGCTATGCCCACATCCTCAGGCTCAGAAGGGAATGTCAAGCTTTGCTC
  CCTAGAAGAAGCTCAAAGGATATGGAAACAAAAGTCGGCAGAGATTTATCCAATAATGGA
  CAAGTCAAGCCGCACACGTCTTGCTCTCATTATCTGCAATGAAGAATTTGACAGTATTCC
  TAGAAGAACTGGAGCTGAGGTTGACATCACAGGCATGACAATGCTGCTACAAAATCTGGG
  GTACAGCGTAGATGTGAAAAAAAATCTCACTGCTTCGGACATGACTACAGAGCTGGAGGC
  ATTTGCACACCGCCCAGAGCACAAGACCTCTGACAGCACGTTCCTGGTGTTCATGTCTCA
  TGGTATTCGGGAAGGCATTTGTGGGAAGAAACACTCTGAGCAAGTCCCAGATATACTACA
  ACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTGAAGGACAAACC
  GAAGGTGATCATCATCCAGGCCTGCCGTGGTGACAGCCCTGGTGTGGTGTGGTTTAAAGA
  TTCAGTAGGAGTTTCTGGAAACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGC
  TATTAAGAAAGCCCACATAGAGAAGGATTTTATCGCTTTCTGCTCTTCCACACCAGATAA
  TGTTTCTTGGAGACATCCCACAATGGGCTCTGTTTTTATTGGAAGACTCATTGAACATAT
  GCAAGAATATGCCTGTTCCTGTGATGTGGAGGAAATTTTCCGCAAGGTTCGATTTTCATT
  TGAGCAGCCAGATGGTAGAGCGCAGATGCCCACCACTGAAAGAGTGACTTTGACAAGATG
  TTTCTACCTCTTCCCAGGACATTAAAATAAGGAAACTGTATGAATGTCTGTGGGCAGGAA
  GTGAAGAGATCCTTCTGTAAAGGTTTTTGGAATTATGTCTGCTGAATAATAAACTTTTTT
  GAAATAATAAATCTGGTAGAAAAATGAAAAAAAAAAAAAAAAAAAAAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_033292
• Insert Size: 1400 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_033292.2, NP_150634.1
• RefSeq Size: 1364 bp
• RefSeq ORF: 1215 bp
• Locus ID: 834
• Cytogenetics: 11q22.3
• Domains: Peptidase_C14, CARD, CASc
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Amyotrophic lateral sclerosis (ALS), Cytosolic DNA-sensing pathway, NOD-like receptor signaling pathway
• Gene Summary: 'This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]'
  Transcript Variant: This variant (alpha) encodes the longest isoform (alpha). Variant alpha and variant 6 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.