ATP1B4 (NM_012069) Human Untagged Clone

CAT#: SC308949

ATP1B4 (untagged)-Human ATPase, Na+/K+ transporting, beta 4 polypeptide (ATP1B4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP1B4
• Synonyms: ATPase, (Na+)/K+ transporting, beta 4 polypeptide; OTTHUMP00000023940; X,K-ATPase beta-m subunit
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_012069, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGAAGGCAACTCCGGTCCAGAAGGGCTCCATCCTTTCCTTACAGTTATCGCTACAGACTCGATGATC
  CGGATGAAGCGAACCAGAACTACTTAGCAGATGAAGAGGAGGAAGCAGAAGAAGAGGCTCGGGTGACGGT
  GGTGCCCAAATCGGAGGAGGAGGAAGAAGAGGAGGAGAAAGAAGAGGAGGAAGAGGAGGAAAAGGAGGAG
  GAAGAGGGTCAAGGTCAGCCAACAGGCAATGCCTGGTGGCAGAAATTGCAGATCATGAGTGAATACCTGT
  GGGATCCAGAGAGAAGGATGTTTCTGGCCCGAACAGGCCTGATCTTACTCATTTACTTCTTCTTCTATGC
  CTCCTTGGCTGCTGTGATCACCCTCTGCATGTACACACTATTTCTGACCATCAGTCCCTATATACCAACC
  TTCACGGAGCGGGTAAAGCCTCCTGGAGTTATGATCAGACCCTTCGCCCATAGCCTTAACTTCAACTTCA
  ACGTTTCTGAACCCGACACTTGGCAGCATTATGTGATTAGCCTAAATGGCTTTCTCCAGGGTTATAATGA
  CAGTCTTCAAGAGGAAATGAATGTAGATTGTCCCCCGGGGCAGTACTTCATCCAAGATGGCAATGAGGAT
  GAGGACAAGAAGGCCTGCCAATTTAAGCGCTCCTTCCTAAAGAACTGCTCTGGTCTGGAGGACCCAACTT
  TTGGATACTCTACTGGACAGCCCTGCATCCTTCTAAAGATGAACCGGATTGTAGGCTTTCGTCCTGAGCT
  TGGAGATCCTGTGAAGGTTTCCTGCAAAGTTCAGAGAGGTGATGAAAATGACATCCGATCCATCAGTTAC
  TACCCAGAGTCGGCTTCTTTTGACCTCCGCTACTACCCTTACTACGGCAAACTGACTCACGTTAACTACA
  CATCCCCCTTGGTGGCAATGCACTTTACAGACGTGGTGAAGAACCAAGCAGTGCCTGTGCAGTGCCAACT
  GAAGGGCAAAGGCGTCATAAATGATGTCATCAATGATCGTTTTGTGGGCAGGGTAATCTTTACCCTGAAC
  ATAGAAACTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_012069
• ORF Size: 1062 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_012069.4, NP_036201.1
• RefSeq Size: 4761
• RefSeq ORF: 1062
• Locus ID: 23439
• Protein Families: Transmembrane
• Protein Pathways: Cardiac muscle contraction
• Gene Summary: This gene has been found in all vertebrate genomes sequenced to date. However, this gene has undergone a change in function in placental mammals compared to other species. Specifically, in fish, avian, and amphibian species, this gene encodes plasma membrane-bound beta-subunits of Na,K-ATPase. In placental mammals, the encoded protein interacts with the nuclear transcriptional coregulator SKIP and may be involved in the regulation of TGF-beta signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site that deletes 12 nts in the 5' coding region, compared to variant 1. This variant encodes isoform B which is 4 aa shorter than isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.