G protein alpha inhibitor 1 (GNAI1) (NM_002069) Human Untagged Clone
CAT#: SC309030
GNAI1 (untagged)-Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1)
"NM_002069" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GNAI1 |
Synonyms | Gi |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_002069 edited
ATGGGCTGCACGCTGAGCGCCGAGGACAAGGCGGCGGTGGAGCGGAGTAAGATGATCGAC CGCAACCTCCGTGAGGACGGCGAGAAGGCGGCGCGCGAGGTCAAGCTGCTGCTGCTCGGT GCTGGTGAATCTGGTAAAAGTACAATTGTGAAGCAGATGAAAATTATCCATGAAGCTGGT TATTCAGAAGAGGAGTGTAAACAATACAAAGCAGTGGTCTACAGTAACACCATCCAGTCA ATTATTGCTATCATTAGGGCTATGGGGAGGTTGAAGATAGACTTTGGTGACTCAGCCCGG GCGGATGATGCACGCCAACTCTTTGTGCTAGCTGGAGCTGCTGAAGAAGGCTTTATGACT GCAGAACTTGCTGGAGTTATAAAGAGATTGTGGAAAGATAGTGGTGTACAAGCCTGTTTC AACAGATCCCGAGAGTACCAGCTTAATGATTCTGCAGCATACTATTTGAATGACTTGGAC AGAATAGCTCAACCAAATTACATCCCGACTCAACAAGATGTTCTCAGAACTAGAGTGAAA ACTACAGGAATTGTTGAAACCCATTTTACTTTCAAAGATCTTCATTTTAAAATGTTTGAT GTGGGAGGTCAGAGATCTGAGCGGAAGAAGTGGATTCATTGCTTCGAAGGAGTGACGGCG ATCATCTTCTGTGTAGCACTGAGTGACTACGACCTGGTTCTAGCTGAAGATGAAGAAATG AACCGAATGCATGAAAGCATGAAATTGTTTGACAGCATATGTAACAACAAGTGGTTTACA GATACATCCATTATACTTTTTCTAAACAAGAAGGATCTCTTTGAAGAAAAAATCAAAAAG AGCCCTCTCACTATATGCTATCCAGAATATGCAGGATCAAACACATATGAAGAGGCAGCT GCATATATTCAATGTCAGTTTGAAGACCTCAATAAAAGAAAGGACACAAAGGAAATATAC ACCCACTTCACATGTGCCACAGATACTAAGAATGTGCAGTTTGTTTTTGATGCTGTAACA GATGTCATCATAAAAAATAATCTAAAAGATTGTGGTCTCTTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_002069 |
ORF Size | 1065 bp |
Insert Size | 2300 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_002069.5. |
Reference Data | |
RefSeq | NM_002069.4, NP_002060.4 |
RefSeq Size | 3342 |
RefSeq ORF | 1065 |
Locus ID | 2770 |
Domains | G-alpha |
Protein Families | Druggable Genome |
Protein Pathways | Axon guidance, Chemokine signaling pathway, Gap junction, Leukocyte transendothelial migration, Long-term depression, Melanogenesis, Progesterone-mediated oocyte maturation, Tight junction |
Gene Summary | Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205289 | GNAI1 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1) |
USD 420.00 |
|
RG205289 | GNAI1 (GFP-tagged) - Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1) |
USD 460.00 |
|
RC205289L1 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), Myc-DDK-tagged |
USD 768.00 |
|
RC205289L2 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), mGFP tagged |
USD 620.00 |
|
RC205289L3 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), Myc-DDK-tagged |
USD 620.00 |
|
RC205289L4 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review