Betacellulin (BTC) (NM_001729) Human Untagged Clone

CAT#: SC309035

BTC (untagged)-Human betacellulin (BTC)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BTC
• Synonyms: betacellulin; OTTHUMP00000160600
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001729, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACCGGGCCGCCCGGTGCAGCGGCGCCAGCTCCCTGCCACTGCTCCTGGCCCTTGCCCTGGGTCTAG
  TGATCCTTCACTGTGTGGTGGCAGATGGGAATTCCACCAGAAGTCCTGAAACTAATGGCCTCCTCTGTGG
  AGACCCTGAGGAAAACTGTGCAGCTACCACCACACAATCAAAGCGGAAAGGCCACTTCTCTAGGTGCCCC
  AAGCAATACAAGCATTACTGCATCAAAGGGAGATGCCGCTTCGTGGTGGCCGAGCAGACGCCCTCCTGTG
  TCTGTGATGAAGGCTACATTGGAGCAAGGTGTGAGAGAGTTGACTTGTTTTACCTAAGAGGAGACAGAGG
  ACAGATTCTGGTGATTTGTATGATAGCAGTTATGGTAGTTTTTATTATTTTGGTCATCGGTGTCTGCACA
  TGCTGTCACCCTCTTCGGAAACGTCGTAAAAGAAAGAAGAAAGAAGAAGAAATGGAAACTCTGGGTAAAG
  ATATAACTCCTATCAATGAAGATATTGAAGAGACAAATATTGCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001729
• Insert Size: 2100 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001729.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001729.1, NP_001720.1
• RefSeq Size: 1323 bp
• RefSeq ORF: 537 bp
• Locus ID: 685
• Cytogenetics: 4q13.3
• Domains: EGF
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Transmembrane
• Protein Pathways: ErbB signaling pathway
• Gene Summary: 'This gene encodes a member of the epidermal growth factor (EGF) family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the secreted growth factor. A secreted form and a membrane-anchored form of this protein bind to multiple different EGF receptors. This protein promotes pancreatic cell proliferation and insulin secretion, as well as retinal vascular permeability. Mutations in this gene may be associated with type 2 diabetes in human patients. [provided by RefSeq, Nov 2015]'
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.