PRMT1 (NM_001536) Human Untagged Clone

CAT#: SC309036

PRMT1 (untagged)-Human protein arginine methyltransferase 1 (PRMT1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRMT1
• Synonyms: ANM1; HCP1; HRMT1L2; IR1B4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001536, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCAGCCGAGGCCGCGAACTGCATCATGGAGAATTTTGTAGCCACCTTGGCTAATGGGATGAGCC
  TCCAGCCGCCTCTTGAAGAAGTGTCCTGTGGCCAGGCGGAAAGCAGTGAGAAGCCCAACGCTGAGGACAT
  GACATCCAAAGATTACTACTTTGACTCCTACGCACACTTTGGCATCCACGAGGAGATGCTGAAGGACGAG
  GTGCGCACCCTCACTTACCGCAACTCCATGTTTCATAACCGGCACCTCTTCAAGGACAAGGTGGTGCTGG
  ACGTCGGCTCGGGCACCGGCATCCTCTGCATGTTTGCTGCCAAGGCCGGGGCCCGCAAGGTCATCGGGAT
  CGAGTGTTCCAGTATCTCTGATTATGCGGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGACC
  ATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTCCCAGTGGAGAAGGTGGACATCATCATCAGCGAGTGGA
  TGGGCTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGCGCC
  CGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTATGTGACGGCCATCGAGGACCGGCAGTACAAAGAC
  TACAAGATCCACTGGTGGGAGAACGTGTATGGCTTCGACATGTCTTGCATCAAAGATGTGGCCATTAAGG
  AGCCCCTAGTGGATGTCGTGGACCCCAAACAGCTGGTCACCAACGCCTGCCTCATAAAGGAGGTGGACAT
  CTATACCGTCAAGGTGGAAGACCTGACCTTCACCTCCCCGTTCTGCCTGCAAGTGAAGCGGAATGACTAC
  GTGCACGCCCTGGTGGCCTACTTCAACATCGAGTTCACACGCTGCCACAAGAGGACCGGCTTCTCCACCA
  GCCCCGAGTCCCCGTACACGCACTGGAAGCAGACGGTGTTCTACATGGAGGACTACCTGACCGTGAAGAC
  GGGCGAGGAGATCTTCGGCACCATCGGCATGCGGCCCAACGCCAAGAACAACCGGGACCTGGACTTCACC
  ATCGACCTGGACTTCAAGGGCCAGCTGTGCGAGCTGTCCTGCTCCACCGACTACCGGATGCGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001536
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001536.5, NP_001527.3
• RefSeq Size: 1450 bp
• RefSeq ORF: 1116 bp
• Locus ID: 3276
• Cytogenetics: 19q13.33
• Gene Summary: 'This gene encodes a member of the protein arginine N-methyltransferase (PRMT) family. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to terminal guanidino nitrogen atoms. The encoded protein is a type I PRMT and is responsible for the majority of cellular arginine methylation activity. Increased expression of this gene may play a role in many types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]'
  Transcript Variant: This variant (1) encodes the longest isoform (1).