Retinal protein 4 (UNC119) (NM_054035) Human Untagged Clone

CAT#: SC309075

UNC119 (untagged)-Human unc-119 homolog (C. elegans) (UNC119), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UNC119
• Synonyms: HRG4; IMD13; POC7; POC7A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_054035, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGTGAAGAAGGGCGGCGGTGGGGCCGGGACGGCGACGGAGTCCGCTCCGGGGCCCTCGGGCCAGA
  GCGTGGCCCCCATACCACAGCCGCCTGCGGAATCCGAATCTGGGTCCGAGTCGGAGCCGGACGCAGGCCC
  AGGGCCCAGGCCGGGGCCGCTGCAGAGGAAGCAGCCGATCGGGCCGGAGGACGTGCTGGGGCTGCAGCGG
  ATCACCGGTGACTACCTCTGCTCCCCTGAGGAGAATATCTACAAGATCGACTTTGTCAGGTTTAAGATTC
  GGGACATGGACTCAGGCACTGTCCTCTTTGAAATCAAGAAGCCCCCAGTCTCAGAACGGTTGCCCATCAA
  CCGGCGGGACCTGGACCCCAATGCTGGGCGCTTTGTCCGCTACCAGTTCACGCCTGCCTTCCTCCGCCTG
  AGGCAGGTGGGAGCCACGGTGGAGTTCACAGTGGGAGACAAGCCTGTCAACAACTTCCGCATGATCGAGA
  GGCACTACTTCCGCAACCAGCTACTCAAAAGCTTCGACTTCCACTTTGGCTTCTGCATCCCCAGCAGCAA
  GAACACCTGCGAGCACATTTACGACTTCCCCCCTCTCTCCGAGGAGCTGAGTGCGCGGGCAGGGTCTTCT
  GGGAGTGGGGAAGTGGGGGCGTCTAGAGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_054035
• ORF Size: 663 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_054035.2, NP_473376.1
• RefSeq Size: 1665
• RefSeq ORF: 663
• Locus ID: 9094
• Protein Families: Druggable Genome, Stem cell - Pluripotency
• Gene Summary: This gene is specifically expressed in the photoreceptors in the retina. The encoded product shares strong homology with the C. elegans unc119 protein and it can functionally complement the C. elegans unc119 mutation. It has been localized to the photoreceptor synapses in the outer plexiform layer of the retina, and suggested to play a role in the mechanism of photoreceptor neurotransmitter release through the synaptic vesicle cycle. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) has an additional segment in the 3' region compared to transcript variant 1. This results in a shorter isoform (b) with a distinct C-terminus compared to isoform a.