Relaxin 2 (RLN2) (NM_134441) Human Untagged Clone

CAT#: SC309115

RLN2 (untagged)-Human relaxin 2 (RLN2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RLN2
• Synonyms: bA12D24.1.1; bA12D24.1.2; H2; H2-RLX; RLXH2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_134441 edited
  ATGCCTCGCCTGTTTTTTTTCCACCTGCTAGGAGTCTGTTTACTACTGAACCAATTTTCC
  AGAGCAGTCGCGGACTCATGGATGGAGGAAGTTATTAAATTATGCGGCCGCGAATTAGTT
  CGCGCGCAGATTGCCATTTGCGGCATGAGCACCTGGAGCAAAAGGTCTCTGAGCCAGGAA
  GATGCTCCTCAGACACCTAGACCAGTGGCAGAAATTGTGCCATCCTTCATCAACAAAGAT
  ACAGAAACCATAAATATGATGTCAGAATTTGTTGCTAATTTGCCACAGGAGCTGAAGTTA
  ACCCTGTCTGAGATGCAGCCAGCATTACCACAGCTACAACAACATGTACCTGTATTAAAA
  GATTCCAGTCTTCTCTTTGAAGAATTTAAGAAACTTATTCGCAATAGACAAAGTGAAGCC
  GCAGACAGCAGTCCTTCAGAATTAAAATACTTAGGCTTGGATACTCATTCTCGAAAAAAG
  AGACAACTCTACAGTGCATTGGCTAATAAATGTTGCCATGTTGGTTGTACCAAAAGATCT
  CTTGCTAGATTTTGCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_134441
• Insert Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_134441.1, NP_604390.1
• RefSeq Size: 788 bp
• RefSeq ORF: 558 bp
• Locus ID: 6019
• Cytogenetics: 9p24.1
• Protein Families: Secreted Protein
• Gene Summary: 'This gene encodes a member of the relaxin subfamily and insulin superfamily of peptide hormones. In humans there are three non-allelic relaxin genes. This gene encodes multiple protein isoforms, at least one of which undergoes proteolytic processing. This processing generates relaxin A and B chains that are linked by disulfide bonds to form the mature peptide hormone. This hormone plays a role in the male and female reproductive systems and was initially noted for its role in pregnancy. This protein also plays broader roles in the cardiovascular system, including in the regulation of blood pressure and control of heart rate, and data from animal models shows that this protein may have anti-fibrotic and cardioprotective effects. [provided by RefSeq, Jul 2016]'
  Transcript Variant: This variant (1) encodes the longest isoform (1).