Tau (MAPT) (NM_173727) Human Untagged Clone

CAT#: SC309206

MAPT (untagged)-Human microtubule-associated protein tau (MAPT)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAPT
• Synonyms: DDPAC; FLJ31424; FTDP-17; G protein beta1/gamma2 subunit-interacting factor 1; MAPTL; MGC138549; microtubule-associated protein tau; microtubule-associated protein tau, isoform 4; MSTD; MTBT1; MTBT2; PPND; TAU
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_173727 edited
  GCCCACAGCAGCAGGCTGGGTGTCTTGGTTGTCAGTGGTGGCACCAGGATGGAAGGGCAA
  GGCACCCAGGGCAGGCCCACAGTCCCGCTGTCCCCCACTTGCACCCTAGCTTGTAGCTGC
  CAACCTCCCAGACAGCCCAGCCCGCTGCTCAGCTCCACATGCATAGTATCAGCCCTCCAC
  ACCCGACAAAGGGGAACACACCCCCTTGGAAATGGTTCTTTTCCCCCAGTCCCAGCTGGA
  AGCCATGCTGTCTGTTCTGCTGGAGCAGCTGAACATATACATAGATGTTGCCCTGCCCTC
  CCCATCTGCACCCTGTTGAGTTGTAGTTGGATTTGTCTGTTTATGCTTGGATTCACCAGA
  GTGACTATGATAGTGAAAAGAAAAAAAAAAAAAAAAAAGGACGCATGTATCTTGAAATGC
  TTGTAAAGAGGTTTCTAACCCACCCTCACGAGGTGTCTCTCA
  
• Restriction Sites: Please inquire
• ACCN: NM_173727
• Insert Size: 400 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_173727.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_173727.1, NP_776088.1
• RefSeq Size: 2946 bp
• RefSeq ORF: 2946 bp
• Locus ID: 4137
• Cytogenetics: 17q21.31
• Protein Families: Druggable Genome
• Protein Pathways: Alzheimer's disease, MAPK signaling pathway
• Gene Summary: 'This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]'