ASB6 (NM_177999) Human Untagged Clone

CAT#: SC309257

ASB6 (untagged)-Human ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ASB6
• Synonyms: FLJ20548; MGC1024
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_177999, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGTTCCTGCACGGCTTCCGGAGGATCATCTTCGAGTACCAGCCGCTGGTGGATGCGATTCTGGGCT
  CCCTGGGGATCCAGGACCCCGAGCGGCAGGAGTCTCTGGACCGGCCCAGTTATGTCGCCAGCGAGGAGAG
  CCGAATCCTTGTTCTCACTGAGCTGCTGGAGAGGAAAGCCCACTCTCCCTTTTACCAGGAAGGCGTGAGC
  AACGCCCTGCTCAAGATGGCTGAGCTGGGGCTGACGCGGGCGGCCGACGTTCTCTTGCGGCATGGGGCCA
  ATCTCAACTTTGAAGACCCAGTCACCTACTACACGGCCTTGCACATCGCCGTCCTGCGGAACCAGCCGGA
  CATGGTGGAGCTGCTGGTGCATCACGGGGCCGACGTTAATCGGAGGGACCGGGAAAAACTGCTCTGCTCC
  ATGCTCTGGCCAGCAGCGACGGGGTGCAGATCCACAATACTGAGAACATTCGTCTCTTACTGGAAGGAGG
  GGCAGACGTCAAGGCCACCACCAAAGATGGGGACACAGTGTTCACCTGCATCATCTTCCTGCTTGGTGAG
  ACCGTGGGAGGGGACAAAGAGGAGGCCCAGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_177999
• ORF Size: 594 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_177999.2, NP_821066.1
• RefSeq Size: 4548
• RefSeq ORF: 594
• Locus ID: 140459
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene belongs to a family of ankyrin repeat proteins that, along with four other protein families, contain a C-terminal SOCS box motif. Growing evidence suggests that the SOCS box, similar to the F-box, acts as a bridge between specific substrate-binding domains and the more generic proteins that comprise a large family of E3 ubiquitin protein ligases. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a unique C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.